FvH4_5g21460

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000985
Physical Location & Seq
Reverse (-)
12928695 .. 12932422
3728 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g21460.t9

Sequence Viewer

Length: 300 bp
ATGGCCTCCTTTGCCGCCAGGTCCATGCTCCGCTCCGCCGCCGCCAGAACCACCACCCTAGGTTCTCGGGTCGCCTCCGCTGCTCGACCAAAACCCGCCTCCGCACCATTCAGCATCCCCAAGCAAAACAAAAACCCCATCTCTCACGCCATTTTCAGGTCGCCTGTGGAGTTGAGCTGCTGCGTGGAGACGCTGCTTCCCTATCACACTGCCACAGCCTCTGCATTGCTTACTTCCATGCTCTCTGTCTCGCAACGCTCCTGCGGTTGGACCCCTGAAGCTTGCAATGATGAATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

10.48

Weight (kDa)

9.3

Isoelectric Point (pI)

70.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 33
AciI CCGC 9 cut(s) 15, 31, 36, 39, 42, 78, 96, 102, 264
AcuI CTGAAG 1 cut(s) 297
AfiI CCNNNNNNNGG 2 cut(s) 156, 267
AjnI CCWGG 1 cut(s) 17
AluBI AGCT 2 cut(s) 177, 281
AluI AGCT 2 cut(s) 177, 281
Alw26I GTCTC 2 cut(s) 182, 253
AlwNI CAGNNNCTG 1 cut(s) 221
Ama87I CYCGRG 1 cut(s) 66
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 4 cut(s) 80, 177, 180, 193
AspA2I CCTAGG 1 cut(s) 58
AspS9I GGNCC 2 cut(s) 21, 270
AvaI CYCGRG 1 cut(s) 66
AvaII GGWCC 2 cut(s) 21, 270
AvrII CCTAGG 1 cut(s) 58
BbvI GCAGC 4 cut(s) 67, 164, 167, 180
BccI CCATC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 19
BcoDI GTCTC 2 cut(s) 182, 253
BfaI CTAG 1 cut(s) 59
BisI GCNGC 7 cut(s) 15, 39, 42, 81, 178, 181, 194
BlnI CCTAGG 1 cut(s) 58
BlsI GCNGC 7 cut(s) 16, 40, 43, 82, 179, 182, 195
Bme1390I CCNGG 1 cut(s) 19
Bme18I GGWCC 2 cut(s) 21, 270
BmeT110I CYCGRG 1 cut(s) 66
BmgT120I GGNCC 2 cut(s) 21, 270
BmiI GGNNCC 1 cut(s) 272
BmrFI CCNGG 1 cut(s) 19
BmsI GCATC 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 2 cut(s) 156, 267
Bse3DI GCAATG 2 cut(s) 224, 292
BseBI CCWGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 58
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 2 cut(s) 156, 267
BseMI GCAATG 2 cut(s) 224, 292
BseXI GCAGC 4 cut(s) 67, 164, 167, 180
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 156, 267
BsmAI GTCTC 2 cut(s) 182, 253
BsmBI CGTCTC 1 cut(s) 182
BsmI GAATGC 1 cut(s) 299
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 66
BspACI CCGC 9 cut(s) 15, 31, 36, 39, 42, 78, 96, 102, 264
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 272
BsrBI CCGCTC 1 cut(s) 33
BsrDI GCAATG 2 cut(s) 224, 292
BssECI CCNNGG 1 cut(s) 58
BssT1I CCWWGG 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 283
BstF5I GGATG 1 cut(s) 114
BstMAI GTCTC 2 cut(s) 182, 253
BstMWI GCNNNNNNNGC 2 cut(s) 11, 80
BstNI CCWGG 1 cut(s) 19
BstSCI CCNGG 1 cut(s) 17
BstV1I GCAGC 4 cut(s) 67, 164, 167, 180
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 207
Cac8I GCNNGC 1 cut(s) 283
CaiI CAGNNNCTG 1 cut(s) 221
Cfr13I GGNCC 2 cut(s) 21, 270
CseI GACGC 1 cut(s) 199
CviAII CATG 2 cut(s) 25, 238
CviJI RGCY 4 cut(s) 5, 177, 218, 281
CviKI_1 RGCY 4 cut(s) 5, 177, 218, 281
EciI GGCGGA 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 58
Eco47I GGWCC 2 cut(s) 21, 270
Eco57I CTGAAG 1 cut(s) 297
Eco88I CYCGRG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 17
EcoT14I CCWWGG 1 cut(s) 58
ErhI CCWWGG 1 cut(s) 58
Esp3I CGTCTC 1 cut(s) 182
FaeI CATG 2 cut(s) 28, 241
FaiI YATR 2 cut(s) 26, 239
FatI CATG 2 cut(s) 24, 237
FauI CCCGC 1 cut(s) 103
Fnu4HI GCNGC 7 cut(s) 15, 39, 42, 81, 178, 181, 194
FokI GGATG 1 cut(s) 101
Fsp4HI GCNGC 7 cut(s) 15, 39, 42, 81, 178, 181, 194
FspBI CTAG 1 cut(s) 59
GluI GCNGC 7 cut(s) 15, 39, 42, 81, 178, 181, 194
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 199
Hin1II CATG 2 cut(s) 28, 241
HindIII AAGCTT 1 cut(s) 279
HpyCH4V TGCA 2 cut(s) 224, 285
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 80
Hsp92II CATG 2 cut(s) 28, 241
LmnI GCTCC 3 cut(s) 33, 38, 263
LpnPI CCDG 7 cut(s) 4, 31, 58, 142, 177, 274, 288
Lsp1109I GCAGC 4 cut(s) 67, 164, 167, 180
LweI GCATC 1 cut(s) 123
MaeI CTAG 1 cut(s) 59
MbiI CCGCTC 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 248
MnlI CCTC 4 cut(s) 16, 85, 109, 229
MspA1I CMGCKG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 19
Mva1269I GAATGC 1 cut(s) 299
MvaI CCWGG 1 cut(s) 19
MwoI GCNNNNNNNGC 2 cut(s) 11, 80
NlaIII CATG 2 cut(s) 28, 241
NlaIV GGNNCC 1 cut(s) 272
PctI GAATGC 1 cut(s) 299
PkrI GCNGC 7 cut(s) 16, 40, 43, 82, 179, 182, 195
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
PspN4I GGNNCC 1 cut(s) 272
PspPI GGNCC 2 cut(s) 21, 270
PstNI CAGNNNCTG 1 cut(s) 221
SatI GCNGC 7 cut(s) 15, 39, 42, 81, 178, 181, 194
Sau96I GGNCC 2 cut(s) 21, 270
ScrFI CCNGG 1 cut(s) 19
SetI ASST 5 cut(s) 23, 64, 161, 179, 283
SfaNI GCATC 1 cut(s) 123
SinI GGWCC 2 cut(s) 21, 270
SsiI CCGC 9 cut(s) 15, 31, 36, 39, 42, 78, 96, 102, 264
SspMI CTAG 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 58
TaqI TCGA 1 cut(s) 85
TauI GCSGC 3 cut(s) 17, 41, 44
TscAI CASTG 1 cut(s) 214
TseI GCWGC 4 cut(s) 80, 177, 180, 193
TspRI CASTG 1 cut(s) 214
VpaK11BI GGWCC 2 cut(s) 21, 270
XmaJI CCTAGG 1 cut(s) 58
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.