Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002034.1

Orthogroup ID

OG0000985

Physical Location & Seq

Genomic Coordinates Forward (+)

21945 .. 22535

Gene Structure 591 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002034.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

atgtcctccttggccgctaggtcagtgctccgctccaccgcgtctcgaaccacccagctgcgttcgaggctcggtttcgcagccaaaaccaaaccagtcgcctcaccctttagcatccccaaacaagaccagaacctactctctcatcgcatcttcaggtcgcctgtggagttgagctgctgcgtggagacgttgcttccctaccatacagccacagcctctgcattactcacttcgaagctagaagtctcgcaacgctcctatgttttgatccctgaagcggttcattttagttgcggttatgttcaatttcacgggctgatggggaagccaatttgtgttaagcaaagctgtgaattgcaaaagacgacgcttttgtattgtttgaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

130

Amino Acids

14.36

Weight (kDa)

9.61

Isoelectric Point (pI)

65.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000985)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT2G33847 AT2G33847
fragaria_vesca	FvH4_3g02420 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460
malus_domestica	MD05G1310800.v1.1 MD10G1289900.v1.1
prunus_persica	Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1
pyrus_communis	pycom05g28710 pycom10g24220
rosa_chinensis	RchiOBHm_Chr5g0009081
rosa_multiflora	Rmu_sc0002034.1_g000006 Rmu_sc0002034.1_g000007
rosa_roxburghii	Rroxscaffold_1G00066900 Rroxscaffold_1G00066920 Rroxscaffold_1G00069900
rosa_rugosa	Rorug04G0441000
rosa_samantha	Rh5AG070200 Rh5AG070400 Rh5BG067100 Rh5BG067200 Rh5CG078400 Rh5CG078600 Rh5DG066600
rosa_wichuraiana	Rw5G006560 Rw5G006570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	33
AccII	CGCG	1 cut(s)	41
AciI	CCGC	5 cut(s)	15, 31, 39, 281, 297
AclWI	GGATC	1 cut(s)	265
AcoI	YGGCCR	1 cut(s)	12
AcuI	CTGAAG	2 cut(s)	139, 297
AfiI	CCNNNNNNNGG	1 cut(s)	280
AgsI	TTSAA	2 cut(s)	308, 388
AluBI	AGCT	4 cut(s)	58, 177, 241, 351
AluI	AGCT	4 cut(s)	58, 177, 241, 351
Alw21I	GWGCWC	1 cut(s)	30
Alw26I	GTCTC	3 cut(s)	48, 182, 253
AlwI	GGATC	1 cut(s)	265
AlwNI	CAGNNNCTG	1 cut(s)	221
AoxI	GGCC	1 cut(s)	12
ApeKI	GCWGC	4 cut(s)	58, 80, 177, 180
ArsI	GACNNNNNNTTYG	2 cut(s)	358, 390
Asp700I	GAANNNNTTC	1 cut(s)	282
AsuHPI	GGTGA	1 cut(s)	96
AsuII	TTCGAA	1 cut(s)	236
Bbv12I	GWGCWC	1 cut(s)	30
BbvI	GCAGC	4 cut(s)	45, 92, 164, 167
BccI	CCATC	1 cut(s)	316
BcoDI	GTCTC	3 cut(s)	48, 182, 253
BfaI	CTAG	2 cut(s)	18, 242
BisI	GCNGC	5 cut(s)	15, 59, 81, 178, 181
BlsI	GCNGC	5 cut(s)	16, 60, 82, 179, 182
BmsI	GCATC	2 cut(s)	123, 159
Bpu14I	TTCGAA	1 cut(s)	236
BsaJI	CCNNGG	1 cut(s)	9
Bsc4I	CCNNNNNNNGG	1 cut(s)	280
Bse1I	ACTGG	1 cut(s)	95
BseDI	CCNNGG	1 cut(s)	9
BseGI	GGATG	1 cut(s)	114
BseLI	CCNNNNNNNGG	1 cut(s)	280
BseNI	ACTGG	1 cut(s)	95
BseXI	GCAGC	4 cut(s)	45, 92, 164, 167
BseYI	CCCAGC	1 cut(s)	54
Bsh1236I	CGCG	1 cut(s)	41
BshFI	GGCC	1 cut(s)	14
BsiHKAI	GWGCWC	1 cut(s)	30
BslI	CCNNNNNNNGG	1 cut(s)	280
BsmAI	GTCTC	3 cut(s)	48, 182, 253
BsmBI	CGTCTC	2 cut(s)	48, 182
BsnI	GGCC	1 cut(s)	14
Bsp119I	TTCGAA	1 cut(s)	236
Bsp1286I	GDGCHC	1 cut(s)	30
Bsp143I	GATC	1 cut(s)	270
BspACI	CCGC	5 cut(s)	15, 31, 39, 281, 297
BspANI	GGCC	1 cut(s)	14
BspFNI	CGCG	1 cut(s)	41
BspPI	GGATC	1 cut(s)	265
BspT104I	TTCGAA	1 cut(s)	236
BsrBI	CCGCTC	1 cut(s)	33
BsrI	ACTGG	1 cut(s)	95
BssECI	CCNNGG	1 cut(s)	9
BssMI	GATC	1 cut(s)	270
BssT1I	CCWWGG	1 cut(s)	9
BstBI	TTCGAA	1 cut(s)	236
BstF5I	GGATG	1 cut(s)	114
BstFNI	CGCG	1 cut(s)	41
BstKTI	GATC	1 cut(s)	273
BstMAI	GTCTC	3 cut(s)	48, 182, 253
BstMBI	GATC	1 cut(s)	270
BstMWI	GCNNNNNNNGC	1 cut(s)	67
BstUI	CGCG	1 cut(s)	41
BstV1I	GCAGC	4 cut(s)	45, 92, 164, 167
BsuRI	GGCC	1 cut(s)	14
BtgZI	GCGATG	1 cut(s)	131
BtsCI	GGATG	1 cut(s)	114
BtsIMutI	CAGTG	1 cut(s)	30
CaiI	CAGNNNCTG	1 cut(s)	221
CseI	GACGC	2 cut(s)	30, 379
DpnI	GATC	1 cut(s)	272
DpnII	GATC	1 cut(s)	270
EaeI	YGGCCR	1 cut(s)	12
Eco130I	CCWWGG	1 cut(s)	9
Eco57I	CTGAAG	2 cut(s)	139, 297
EcoT14I	CCWWGG	1 cut(s)	9
ErhI	CCWWGG	1 cut(s)	9
Esp3I	CGTCTC	2 cut(s)	48, 182
FaiI	YATR	3 cut(s)	207, 264, 303
Fnu4HI	GCNGC	5 cut(s)	15, 59, 81, 178, 181
FokI	GGATG	1 cut(s)	101
Fsp4HI	GCNGC	5 cut(s)	15, 59, 81, 178, 181
FspBI	CTAG	2 cut(s)	18, 242
GluI	GCNGC	5 cut(s)	15, 59, 81, 178, 181
GsaI	CCCAGC	1 cut(s)	58
HaeIII	GGCC	1 cut(s)	14
HgaI	GACGC	2 cut(s)	30, 379
HphI	GGTGA	1 cut(s)	96
Hpy188III	TCNNGA	1 cut(s)	45
Hpy99I	CGWCG	1 cut(s)	373
HpyCH4IV	ACGT	1 cut(s)	191
HpyCH4V	TGCA	2 cut(s)	224, 361
HpyF10VI	GCNNNNNNNGC	1 cut(s)	67
HpySE526I	ACGT	1 cut(s)	191
Kzo9I	GATC	1 cut(s)	270
LmnI	GCTCC	3 cut(s)	33, 38, 263
LpnPI	CCDG	6 cut(s)	68, 108, 142, 143, 177, 288
Lsp1109I	GCAGC	4 cut(s)	45, 92, 164, 167
LweI	GCATC	2 cut(s)	123, 159
MaeI	CTAG	2 cut(s)	18, 242
MaeII	ACGT	1 cut(s)	191
MalI	GATC	1 cut(s)	272
MbiI	CCGCTC	1 cut(s)	33
MboI	GATC	1 cut(s)	270
MboII	GAAGA	1 cut(s)	145
MhlI	GDGCHC	1 cut(s)	30
MluCI	AATT	4 cut(s)	308, 333, 356, 388
MnlI	CCTC	4 cut(s)	16, 60, 112, 229
MroXI	GAANNNNTTC	1 cut(s)	282
MseI	TTAA	1 cut(s)	342
MspA1I	CMGCKG	1 cut(s)	58
MvnI	CGCG	1 cut(s)	41
MwoI	GCNNNNNNNGC	1 cut(s)	67
NdeII	GATC	1 cut(s)	270
NspV	TTCGAA	1 cut(s)	236
PdmI	GAANNNNTTC	1 cut(s)	282
PkrI	GCNGC	5 cut(s)	16, 60, 82, 179, 182
PspFI	CCCAGC	1 cut(s)	54
PstNI	CAGNNNCTG	1 cut(s)	221
PvuII	CAGCTG	1 cut(s)	58
SaqAI	TTAA	1 cut(s)	342
SatI	GCNGC	5 cut(s)	15, 59, 81, 178, 181
Sau3AI	GATC	1 cut(s)	270
SduI	GDGCHC	1 cut(s)	30
SetI	ASST	8 cut(s)	23, 60, 138, 161, 179, 194, 243, 353
SfaNI	GCATC	2 cut(s)	123, 159
SfuI	TTCGAA	1 cut(s)	236
Sse9I	AATT	4 cut(s)	308, 333, 356, 388
SsiI	CCGC	5 cut(s)	15, 31, 39, 281, 297
SspMI	CTAG	2 cut(s)	18, 242
StyI	CCWWGG	1 cut(s)	9
TaiI	ACGT	1 cut(s)	194
TaqI	TCGA	3 cut(s)	46, 65, 236
TasI	AATT	4 cut(s)	308, 333, 356, 388
TauI	GCSGC	1 cut(s)	17
Tru1I	TTAA	1 cut(s)	342
Tru9I	TTAA	1 cut(s)	342
TscAI	CASTG	1 cut(s)	30
TseI	GCWGC	4 cut(s)	58, 80, 177, 180
TspDTI	ATGAA	1 cut(s)	275
TspRI	CASTG	1 cut(s)	30
XmnI	GAANNNNTTC	1 cut(s)	282
XspI	CTAG	2 cut(s)	18, 242

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.