Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5B

Orthogroup ID

OG0000985

Physical Location & Seq

Genomic Coordinates Reverse (-)

5527292 .. 5530552

Gene Structure 3261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5BG067200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 309 bp

ATGGCCTCCTTCGCCGCTAGGTCCGTGCTCCGCTCCGCCGCGGCCAGAACCACTCTGGGTTCTCGGGTCGCCTCCGCAGCCCGACCCAAACCCTCCGCCGCACCATTCACCATCCCCAAACAAAACAAAAACCCCATTTTCAGGTCGCCTGTGGAGTTGAGCTGCTGCGTGGAGACGTTGCTTCCCTACCACACGGCCACAGCCTCTGCATTGCTCACCTCGATGCTCTCCGTCTCGCAACGCTCCTACGGTTGGACCCCTGAAGGTATTCCCTCTTTTGCATTCGAATTGAATTTGTTGGATTCGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

102

Amino Acids

10.89

Weight (kDa)

9.89

Isoelectric Point (pI)

59.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000985)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT1G28395 AT2G33847 AT2G33847
fragaria_vesca	FvH4_3g02420 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_3g08700 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460 FvH4_5g21460
malus_domestica	MD05G1310800.v1.1 MD10G1289900.v1.1
prunus_persica	Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1 Prupe.4G051800_v2.0.a1
pyrus_communis	pycom05g28710 pycom10g24220
rosa_chinensis	RchiOBHm_Chr5g0009081
rosa_multiflora	Rmu_sc0002034.1_g000006 Rmu_sc0002034.1_g000007
rosa_roxburghii	Rroxscaffold_1G00066900 Rroxscaffold_1G00066920 Rroxscaffold_1G00069900
rosa_rugosa	Rorug04G0441000
rosa_samantha	Rh5AG070200 Rh5AG070400 Rh5BG067100 Rh5BG067200 Rh5CG078400 Rh5CG078600 Rh5DG066600
rosa_wichuraiana	Rw5G006560 Rw5G006570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	33
AccII	CGCG	1 cut(s)	41
AciI	CCGC	8 cut(s)	15, 31, 36, 39, 41, 75, 96, 99
AcoI	YGGCCR	2 cut(s)	42, 195
AcsI	RAATTY	1 cut(s)	292
AcuI	CTGAAG	1 cut(s)	282
AfiI	CCNNNNNNNGG	2 cut(s)	141, 252
AgsI	TTSAA	1 cut(s)	292
AluBI	AGCT	1 cut(s)	162
AluI	AGCT	1 cut(s)	162
Alw21I	GWGCWC	1 cut(s)	30
Alw26I	GTCTC	2 cut(s)	167, 238
AlwNI	CAGNNNCTG	1 cut(s)	206
Ama87I	CYCGRG	1 cut(s)	63
AoxI	GGCC	3 cut(s)	3, 42, 195
ApeKI	GCWGC	3 cut(s)	77, 162, 165
ApoI	RAATTY	1 cut(s)	292
Asp700I	GAANNNNTTC	1 cut(s)	267
AspS9I	GGNCC	2 cut(s)	21, 255
AsuHPI	GGTGA	2 cut(s)	100, 208
AsuII	TTCGAA	1 cut(s)	285
AvaI	CYCGRG	1 cut(s)	63
AvaII	GGWCC	2 cut(s)	21, 255
Bbv12I	GWGCWC	1 cut(s)	30
BbvI	GCAGC	3 cut(s)	89, 149, 152
BccI	CCATC	1 cut(s)	119
BceAI	ACGGC	1 cut(s)	210
BcoDI	GTCTC	2 cut(s)	167, 238
BfaI	CTAG	1 cut(s)	18
BisI	GCNGC	7 cut(s)	15, 39, 42, 78, 99, 163, 166
BlsI	GCNGC	7 cut(s)	16, 40, 43, 79, 100, 164, 167
Bme18I	GGWCC	2 cut(s)	21, 255
BmeT110I	CYCGRG	1 cut(s)	63
BmgT120I	GGNCC	2 cut(s)	21, 255
BmiI	GGNNCC	1 cut(s)	257
BmsI	GCATC	1 cut(s)	213
Bpu14I	TTCGAA	1 cut(s)	285
BsaJI	CCNNGG	1 cut(s)	39
Bsc4I	CCNNNNNNNGG	2 cut(s)	141, 252
Bse3DI	GCAATG	1 cut(s)	209
BseDI	CCNNGG	1 cut(s)	39
BseGI	GGATG	1 cut(s)	111
BseLI	CCNNNNNNNGG	2 cut(s)	141, 252
BseMI	GCAATG	1 cut(s)	209
BseXI	GCAGC	3 cut(s)	89, 149, 152
Bsh1236I	CGCG	1 cut(s)	41
BshFI	GGCC	3 cut(s)	5, 44, 197
BsiHKAI	GWGCWC	1 cut(s)	30
BsiHKCI	CYCGRG	1 cut(s)	63
BslI	CCNNNNNNNGG	2 cut(s)	141, 252
BsmAI	GTCTC	2 cut(s)	167, 238
BsmBI	CGTCTC	2 cut(s)	167, 238
BsmI	GAATGC	1 cut(s)	281
BsnI	GGCC	3 cut(s)	5, 44, 197
BsoBI	CYCGRG	1 cut(s)	63
Bsp119I	TTCGAA	1 cut(s)	285
Bsp1286I	GDGCHC	1 cut(s)	30
BspACI	CCGC	8 cut(s)	15, 31, 36, 39, 41, 75, 96, 99
BspANI	GGCC	3 cut(s)	5, 44, 197
BspFNI	CGCG	1 cut(s)	41
BspLI	GGNNCC	1 cut(s)	257
BspT104I	TTCGAA	1 cut(s)	285
BsrBI	CCGCTC	1 cut(s)	33
BsrDI	GCAATG	1 cut(s)	209
BssECI	CCNNGG	1 cut(s)	39
Bst4CI	ACNGT	1 cut(s)	251
BstBI	TTCGAA	1 cut(s)	285
BstDSI	CCRYGG	1 cut(s)	39
BstF5I	GGATG	1 cut(s)	111
BstFNI	CGCG	1 cut(s)	41
BstMAI	GTCTC	2 cut(s)	167, 238
BstMWI	GCNNNNNNNGC	2 cut(s)	11, 77
BstUI	CGCG	1 cut(s)	41
BstV1I	GCAGC	3 cut(s)	89, 149, 152
BsuRI	GGCC	3 cut(s)	5, 44, 197
BtgI	CCRYGG	1 cut(s)	39
BtsCI	GGATG	1 cut(s)	111
CaiI	CAGNNNCTG	1 cut(s)	206
Cfr13I	GGNCC	2 cut(s)	21, 255
Cfr42I	CCGCGG	1 cut(s)	42
CviJI	RGCY	6 cut(s)	5, 44, 80, 162, 197, 203
CviKI_1	RGCY	6 cut(s)	5, 44, 80, 162, 197, 203
EaeI	YGGCCR	2 cut(s)	42, 195
EciI	GGCGGA	2 cut(s)	25, 85
Eco47I	GGWCC	2 cut(s)	21, 255
Eco57I	CTGAAG	1 cut(s)	282
Eco88I	CYCGRG	1 cut(s)	63
Esp3I	CGTCTC	2 cut(s)	167, 238
Fnu4HI	GCNGC	7 cut(s)	15, 39, 42, 78, 99, 163, 166
FokI	GGATG	1 cut(s)	98
Fsp4HI	GCNGC	7 cut(s)	15, 39, 42, 78, 99, 163, 166
FspBI	CTAG	1 cut(s)	18
GluI	GCNGC	7 cut(s)	15, 39, 42, 78, 99, 163, 166
HaeIII	GGCC	3 cut(s)	5, 44, 197
HinfI	GANTC	1 cut(s)	302
HphI	GGTGA	2 cut(s)	100, 208
HpyAV	CCTTC	2 cut(s)	19, 257
HpyCH4III	ACNGT	1 cut(s)	251
HpyCH4IV	ACGT	1 cut(s)	176
HpyCH4V	TGCA	2 cut(s)	209, 281
HpyF10VI	GCNNNNNNNGC	2 cut(s)	11, 77
HpySE526I	ACGT	1 cut(s)	176
KspI	CCGCGG	1 cut(s)	42
LmnI	GCTCC	3 cut(s)	33, 38, 248
LpnPI	CCDG	5 cut(s)	41, 58, 127, 162, 273
Lsp1109I	GCAGC	3 cut(s)	89, 149, 152
LweI	GCATC	1 cut(s)	213
MaeI	CTAG	1 cut(s)	18
MaeII	ACGT	1 cut(s)	176
MbiI	CCGCTC	1 cut(s)	33
MhlI	GDGCHC	1 cut(s)	30
MluCI	AATT	2 cut(s)	287, 292
MmeI	TCCRAC	2 cut(s)	233, 279
MnlI	CCTC	6 cut(s)	16, 82, 103, 214, 229, 283
MroXI	GAANNNNTTC	1 cut(s)	267
MslI	CAYNNNNRTG	1 cut(s)	221
MspA1I	CMGCKG	1 cut(s)	41
Mva1269I	GAATGC	1 cut(s)	281
MvnI	CGCG	1 cut(s)	41
MwoI	GCNNNNNNNGC	2 cut(s)	11, 77
NlaIV	GGNNCC	1 cut(s)	257
NspV	TTCGAA	1 cut(s)	285
PctI	GAATGC	1 cut(s)	281
PdmI	GAANNNNTTC	1 cut(s)	267
PfeI	GAWTC	1 cut(s)	302
PkrI	GCNGC	7 cut(s)	16, 40, 43, 79, 100, 164, 167
PspN4I	GGNNCC	1 cut(s)	257
PspPI	GGNCC	2 cut(s)	21, 255
PstNI	CAGNNNCTG	1 cut(s)	206
RseI	CAYNNNNRTG	1 cut(s)	221
SacII	CCGCGG	1 cut(s)	42
SatI	GCNGC	7 cut(s)	15, 39, 42, 78, 99, 163, 166
Sau96I	GGNCC	2 cut(s)	21, 255
SduI	GDGCHC	1 cut(s)	30
SetI	ASST	6 cut(s)	23, 146, 164, 179, 221, 268
SfaNI	GCATC	1 cut(s)	213
Sfr303I	CCGCGG	1 cut(s)	42
SfuI	TTCGAA	1 cut(s)	285
SgrBI	CCGCGG	1 cut(s)	42
SinI	GGWCC	2 cut(s)	21, 255
SmiMI	CAYNNNNRTG	1 cut(s)	221
Sse9I	AATT	2 cut(s)	287, 292
SsiI	CCGC	8 cut(s)	15, 31, 36, 39, 41, 75, 96, 99
SspMI	CTAG	1 cut(s)	18
TaaI	ACNGT	1 cut(s)	251
TaiI	ACGT	1 cut(s)	179
TaqI	TCGA	2 cut(s)	221, 285
TasI	AATT	2 cut(s)	287, 292
TauI	GCSGC	4 cut(s)	17, 41, 44, 101
TfiI	GAWTC	1 cut(s)	302
TseI	GCWGC	3 cut(s)	77, 162, 165
TspGWI	ACGGA	2 cut(s)	13, 220
VpaK11BI	GGWCC	2 cut(s)	21, 255
XapI	RAATTY	1 cut(s)	292
XcmI	CCANNNNNNNNNTGG	1 cut(s)	52
XmnI	GAANNNNTTC	1 cut(s)	267
XspI	CTAG	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.