FvH4_6g33000

ATP synthase g subunit family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0002646
Physical Location & Seq
Reverse (-)
26055902 .. 26058902
3001 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g33000.t1

Sequence Viewer

Length: 369 bp
ATGGCATCAAAGTTACCTCAGTTTCAGACAAAGCTGGTCCAGGCGTCAAACTTATTAGCCAAGAATGGAAATACTTATTACAAGCAGATGATGGAGAAGAACAAAGGCTATATCCAGGAGCCTCCCACCATCGAGAACTGTCAAACAATAGCAAAGCAACTGTTCTATACTCGTCTTGCCAGTATTCCTAGTCGTTACGAAGCATTCTGGAAGGAACTGGACGGTCTCAAGGACGTTATAAAAACCTCACGAGATCTGAATGTGGAGAAAGCTGGCATTGTTGCTCTGTTTGGGGTTGAATGCTTTGCTTGGTTCTGGACTGGTGAGGTTGTAGGAAGGGGTGGTACAATCACAGGCTACTATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 map00190 map01100 map04714
Pfam Domains
Protein Families
ATP-synt_G

Protein Analysis

123

Amino Acids

13.86

Weight (kDa)

9.08

Isoelectric Point (pI)

24.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_G PF04718 16 - 120 7.5e-22 Mitochondrial ATP synthase g subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 239
AcyI GRCGYC 1 cut(s) 44
AfaI GTAC 1 cut(s) 346
AgsI TTSAA 1 cut(s) 299
AjnI CCWGG 2 cut(s) 39, 114
AluBI AGCT 2 cut(s) 34, 272
AluI AGCT 2 cut(s) 34, 272
Alw26I GTCTC 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 335
AvaII GGWCC 1 cut(s) 37
BarI GAAGNNNNNNTAC 2 cut(s) 328, 360
BauI CACGAG 1 cut(s) 249
BccI CCATC 2 cut(s) 85, 137
BciT130I CCWGG 2 cut(s) 41, 116
BcoDI GTCTC 1 cut(s) 230
BfaI CTAG 1 cut(s) 189
BglII AGATCT 1 cut(s) 253
Bme1390I CCNGG 2 cut(s) 41, 116
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 120
BmrFI CCNGG 2 cut(s) 41, 116
BmsI GCATC 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 212
BsaHI GRCGYC 1 cut(s) 44
BsaI GGTCTC 1 cut(s) 230
Bse1I ACTGG 3 cut(s) 180, 222, 325
BseBI CCWGG 2 cut(s) 41, 116
BseMII CTCAG 1 cut(s) 32
BseNI ACTGG 3 cut(s) 180, 222, 325
BsmAI GTCTC 1 cut(s) 230
BsmI GAATGC 2 cut(s) 203, 305
Bso31I GGTCTC 1 cut(s) 230
Bsp143I GATC 1 cut(s) 253
BspCNI CTCAG 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 120
BspTNI GGTCTC 1 cut(s) 230
BsrI ACTGG 3 cut(s) 180, 222, 325
BssMI GATC 1 cut(s) 253
BssNI GRCGYC 1 cut(s) 44
BssSI CACGAG 1 cut(s) 249
Bst2BI CACGAG 1 cut(s) 249
Bst2UI CCWGG 2 cut(s) 41, 116
Bst4CI ACNGT 3 cut(s) 140, 162, 224
BstACI GRCGYC 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 274
BstDEI CTNAG 1 cut(s) 18
BstKTI GATC 1 cut(s) 256
BstMAI GTCTC 1 cut(s) 230
BstMBI GATC 1 cut(s) 253
BstNI CCWGG 2 cut(s) 41, 116
BstSCI CCNGG 2 cut(s) 39, 114
BstX2I RGATCY 1 cut(s) 253
BstYI RGATCY 1 cut(s) 253
Cac8I GCNNGC 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 37
CseI GACGC 1 cut(s) 33
Csp6I GTAC 1 cut(s) 345
CviJI RGCY 6 cut(s) 34, 59, 108, 121, 272, 357
CviKI_1 RGCY 6 cut(s) 34, 59, 108, 121, 272, 357
CviQI GTAC 1 cut(s) 345
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
Eco31I GGTCTC 1 cut(s) 230
Eco47I GGWCC 1 cut(s) 37
EcoRII CCWGG 2 cut(s) 39, 114
FaiI YATR 4 cut(s) 111, 168, 239, 363
FspBI CTAG 1 cut(s) 189
HgaI GACGC 1 cut(s) 33
Hin1I GRCGYC 1 cut(s) 44
HphI GGTGA 1 cut(s) 335
Hpy188I TCNGA 2 cut(s) 27, 258
Hpy188III TCNNGA 4 cut(s) 133, 208, 249, 316
HpyAV CCTTC 2 cut(s) 205, 330
HpyCH4III ACNGT 3 cut(s) 140, 162, 224
HpyCH4IV ACGT 1 cut(s) 234
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 234
Hsp92I GRCGYC 1 cut(s) 44
Kzo9I GATC 1 cut(s) 253
LmnI GCTCC 1 cut(s) 118
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 2 cut(s) 12, 194
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 1 cut(s) 109
MflI RGATCY 1 cut(s) 253
MnlI CCTC 4 cut(s) 27, 132, 256, 319
MseI TTAA 1 cut(s) 367
MspR9I CCNGG 2 cut(s) 41, 116
Mva1269I GAATGC 2 cut(s) 203, 305
MvaI CCWGG 2 cut(s) 41, 116
NdeII GATC 1 cut(s) 253
NlaIV GGNNCC 1 cut(s) 120
PctI GAATGC 2 cut(s) 203, 305
PfoI TCCNGGA 1 cut(s) 114
PsiI TTATAA 1 cut(s) 239
Psp6I CCWGG 2 cut(s) 39, 114
PspGI CCWGG 2 cut(s) 39, 114
PspN4I GGNNCC 1 cut(s) 120
PspPI GGNCC 1 cut(s) 37
PsuI RGATCY 1 cut(s) 253
RsaI GTAC 1 cut(s) 346
RsaNI GTAC 1 cut(s) 345
SaqAI TTAA 1 cut(s) 367
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 2 cut(s) 41, 116
SetI ASST 6 cut(s) 19, 36, 237, 248, 274, 330
SfaNI GCATC 1 cut(s) 14
SinI GGWCC 1 cut(s) 37
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 2 cut(s) 39, 114
TaaI ACNGT 3 cut(s) 140, 162, 224
TaiI ACGT 1 cut(s) 237
TaqI TCGA 1 cut(s) 132
Tru1I TTAA 1 cut(s) 367
Tru9I TTAA 1 cut(s) 367
VpaK11BI GGWCC 1 cut(s) 37
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.