RLG00000019966

ATP synthase g subunit family protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
59326816 .. 59328165
1350 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000019966

Sequence Viewer

Length: 369 bp
ATGGCATCAAAGTTACCTCAGTTGCAGACAAAGCTGGTCCAGGTGTCAAACTTATTAGCCAAGAATGGAAATACCTATTACAAGCAGATGATGGAGAAGAACAAGGGCTATATCCAGGAGCCACCCACCATCGAGAACTGTCAAACATTAGCAAAGCAACTGTTCTATACTCGTCTTGCCAGCATTCCTAGTCGCTACGAAGCATTCTGGAAGGAACTTAAAGGTCTCAAGGACGTTTTAAAAACCACAGGGGAACTGAATGTGGAGAAAGCTGGCATTATTGCTCTGTTTGGGGTCGAGTGCTTTGCTTGGTTCTGGACTGGTGAGGTTGTAGGAAGGGGTGGTACAATCACAGGCTACTATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.81

Weight (kDa)

9.23

Isoelectric Point (pI)

23.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_G PF04718 17 - 120 3.4e-21 Mitochondrial ATP synthase g subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 346
AjnI CCWGG 2 cut(s) 39, 114
AluBI AGCT 2 cut(s) 34, 272
AluI AGCT 2 cut(s) 34, 272
Alw26I GTCTC 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 335
AvaII GGWCC 1 cut(s) 37
BarI GAAGNNNNNNTAC 2 cut(s) 328, 360
BccI CCATC 2 cut(s) 85, 137
BcgI CGANNNNNNTGC 2 cut(s) 287, 321
BciT130I CCWGG 2 cut(s) 41, 116
BcoDI GTCTC 1 cut(s) 230
BfaI CTAG 1 cut(s) 189
Bme1390I CCNGG 2 cut(s) 41, 116
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 120
BmrFI CCNGG 2 cut(s) 41, 116
BmsI GCATC 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 212
BsaI GGTCTC 1 cut(s) 230
Bse1I ACTGG 1 cut(s) 325
BseBI CCWGG 2 cut(s) 41, 116
BseMII CTCAG 1 cut(s) 32
BseNI ACTGG 1 cut(s) 325
BsmAI GTCTC 1 cut(s) 230
BsmI GAATGC 2 cut(s) 183, 203
Bso31I GGTCTC 1 cut(s) 230
BspCNI CTCAG 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 120
BspTNI GGTCTC 1 cut(s) 230
BsrI ACTGG 1 cut(s) 325
Bst2UI CCWGG 2 cut(s) 41, 116
Bst4CI ACNGT 2 cut(s) 140, 162
BstC8I GCNNGC 2 cut(s) 181, 274
BstDEI CTNAG 1 cut(s) 18
BstMAI GTCTC 1 cut(s) 230
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 2 cut(s) 41, 116
BstSCI CCNGG 2 cut(s) 39, 114
Cac8I GCNNGC 2 cut(s) 181, 274
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 345
CviJI RGCY 6 cut(s) 34, 59, 108, 121, 272, 357
CviKI_1 RGCY 6 cut(s) 34, 59, 108, 121, 272, 357
CviQI GTAC 1 cut(s) 345
DdeI CTNAG 1 cut(s) 18
DraI TTTAAA 1 cut(s) 240
Eco31I GGTCTC 1 cut(s) 230
Eco47I GGWCC 1 cut(s) 37
EcoRII CCWGG 2 cut(s) 39, 114
FaiI YATR 3 cut(s) 111, 168, 363
FspBI CTAG 1 cut(s) 189
HphI GGTGA 1 cut(s) 335
Hpy188III TCNNGA 3 cut(s) 133, 208, 316
HpyAV CCTTC 2 cut(s) 205, 330
HpyCH4III ACNGT 2 cut(s) 140, 162
HpyCH4IV ACGT 1 cut(s) 234
HpyCH4V TGCA 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 234
LmnI GCTCC 1 cut(s) 118
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 12
MboII GAAGA 1 cut(s) 109
MnlI CCTC 2 cut(s) 27, 319
MseI TTAA 2 cut(s) 219, 239
MspR9I CCNGG 2 cut(s) 41, 116
Mva1269I GAATGC 2 cut(s) 183, 203
MvaI CCWGG 2 cut(s) 41, 116
MwoI GCNNNNNNNGC 1 cut(s) 31
NlaIV GGNNCC 1 cut(s) 120
PctI GAATGC 2 cut(s) 183, 203
PfoI TCCNGGA 1 cut(s) 114
Psp6I CCWGG 2 cut(s) 39, 114
PspGI CCWGG 2 cut(s) 39, 114
PspN4I GGNNCC 1 cut(s) 120
PspPI GGNCC 1 cut(s) 37
RsaI GTAC 1 cut(s) 346
RsaNI GTAC 1 cut(s) 345
SaqAI TTAA 2 cut(s) 219, 239
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 2 cut(s) 41, 116
SetI ASST 8 cut(s) 19, 36, 45, 77, 226, 237, 274, 330
SfaNI GCATC 1 cut(s) 14
SinI GGWCC 1 cut(s) 37
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 2 cut(s) 39, 114
TaaI ACNGT 2 cut(s) 140, 162
TaiI ACGT 1 cut(s) 237
TaqI TCGA 2 cut(s) 132, 297
Tru1I TTAA 2 cut(s) 219, 239
Tru9I TTAA 2 cut(s) 219, 239
VpaK11BI GGWCC 1 cut(s) 37
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.