Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000482.1

Orthogroup ID

OG0002646

Physical Location & Seq

Genomic Coordinates Reverse (-)

7595 .. 8935

Gene Structure 1341 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000482.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

atggcatcaaagttacctcagttgcagacaaagctggtccaggtgtcaaacttattagccaagaatggaaatacctattacaagcagatgatggagcagaacaagggctatatccaggagccacccaccatcgagaactgtcaaacattagcaaagcaactgttctatactcgtcttgccagcattcctagtcgctacgaagcattctggaaggaacttgaaggtctcaaggacgttttaaaaaccacaggggaactgaatgtggagaaagctggcattattgctctgtttggggtcgagtgctttgcttggttctggaccggtgaggttgtaggaaggggtggtacaatcacaggctactatgtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00190 ko01100 ko04714 map00190 map01100 map04714

Pfam Domains

Protein Families

ATP-synt_G

Protein Analysis

122

Amino Acids

13.81

Weight (kDa)

8.51

Isoelectric Point (pI)

26.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002646)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19680 AT2G19680 AT4G26210 AT4G26210 AT4G29480
fragaria_vesca	FvH4_1g06940 FvH4_6g33000 FvH4_6g33000
malus_domestica	MD02G1073700.v1.1 MD08G1044300.v1.1 MD09G1195500.v1.1 MD15G1203200.v1.1
prunus_persica	Prupe.1G414300_v2.0.a1 Prupe.1G414300_v2.0.a1 Prupe.3G052200_v2.0.a1 Prupe.3G052200_v2.0.a1 Prupe.3G052200_v2.0.a1 Prupe.7G214000_v2.0.a1
pyrus_communis	pycom09g11270 pycom15g18040
rosa_chinensis	RchiOBHm_Chr2g0092881 RchiOBHm_Chr2g0142551
rosa_laevigata	RLG00000019966
rosa_multiflora	Rmu_sc0000482.1_g000001 Rmu_sc0003262.1_g000021 Rmu_ssc0000218.1_g000008
rosa_roxburghii	Rroxscaffold_2G00102530 Rroxscaffold_2G00148750
rosa_rugosa	Rorug02G0029900 Rorug02G0373800
rosa_samantha	Rh2AG075600 Rh2AG425200 Rh2BG077000 Rh2BG435100 Rh2CG079300 Rh2CG411900 Rh2DG074300 Rh2DG445100
rosa_wichuraiana	Rw2G007040 Rw2G034880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	346
AgeI	ACCGGT	1 cut(s)	320
AgsI	TTSAA	1 cut(s)	221
AjnI	CCWGG	2 cut(s)	39, 114
AluBI	AGCT	2 cut(s)	34, 272
AluI	AGCT	2 cut(s)	34, 272
Alw26I	GTCTC	1 cut(s)	230
AsiGI	ACCGGT	1 cut(s)	320
AspS9I	GGNCC	2 cut(s)	37, 318
AsuHPI	GGTGA	1 cut(s)	335
AvaII	GGWCC	2 cut(s)	37, 318
BarI	GAAGNNNNNNTAC	2 cut(s)	328, 360
BccI	CCATC	2 cut(s)	85, 137
BcgI	CGANNNNNNTGC	2 cut(s)	287, 321
BciT130I	CCWGG	2 cut(s)	41, 116
BcoDI	GTCTC	1 cut(s)	230
BfaI	CTAG	1 cut(s)	189
Bme1390I	CCNGG	2 cut(s)	41, 116
Bme18I	GGWCC	2 cut(s)	37, 318
BmgT120I	GGNCC	2 cut(s)	37, 318
BmiI	GGNNCC	1 cut(s)	120
BmrFI	CCNGG	2 cut(s)	41, 116
BmsI	GCATC	1 cut(s)	14
BpuEI	CTTGAG	1 cut(s)	212
BsaI	GGTCTC	1 cut(s)	230
BsaWI	WCCGGW	1 cut(s)	320
Bse118I	RCCGGY	1 cut(s)	320
BseBI	CCWGG	2 cut(s)	41, 116
BseMII	CTCAG	1 cut(s)	32
BshTI	ACCGGT	1 cut(s)	320
BsiSI	CCGG	1 cut(s)	321
BsmAI	GTCTC	1 cut(s)	230
BsmI	GAATGC	2 cut(s)	183, 203
Bso31I	GGTCTC	1 cut(s)	230
BspCNI	CTCAG	1 cut(s)	31
BspLI	GGNNCC	1 cut(s)	120
BspTNI	GGTCTC	1 cut(s)	230
BsrFI	RCCGGY	1 cut(s)	320
BssAI	RCCGGY	1 cut(s)	320
Bst2UI	CCWGG	2 cut(s)	41, 116
Bst4CI	ACNGT	2 cut(s)	140, 162
BstC8I	GCNNGC	2 cut(s)	181, 274
BstDEI	CTNAG	1 cut(s)	18
BstMAI	GTCTC	1 cut(s)	230
BstMWI	GCNNNNNNNGC	1 cut(s)	31
BstNI	CCWGG	2 cut(s)	41, 116
BstSCI	CCNGG	2 cut(s)	39, 114
Cac8I	GCNNGC	2 cut(s)	181, 274
Cfr10I	RCCGGY	1 cut(s)	320
Cfr13I	GGNCC	2 cut(s)	37, 318
Csp6I	GTAC	1 cut(s)	345
CspAI	ACCGGT	1 cut(s)	320
CviJI	RGCY	6 cut(s)	34, 59, 108, 121, 272, 357
CviKI_1	RGCY	6 cut(s)	34, 59, 108, 121, 272, 357
CviQI	GTAC	1 cut(s)	345
DdeI	CTNAG	1 cut(s)	18
DraI	TTTAAA	1 cut(s)	240
Eco31I	GGTCTC	1 cut(s)	230
Eco47I	GGWCC	2 cut(s)	37, 318
EcoRII	CCWGG	2 cut(s)	39, 114
FaiI	YATR	3 cut(s)	111, 168, 363
FspBI	CTAG	1 cut(s)	189
HapII	CCGG	1 cut(s)	321
HpaII	CCGG	1 cut(s)	321
HphI	GGTGA	1 cut(s)	335
Hpy188III	TCNNGA	3 cut(s)	133, 208, 316
HpyAV	CCTTC	3 cut(s)	205, 215, 330
HpyCH4III	ACNGT	2 cut(s)	140, 162
HpyCH4IV	ACGT	1 cut(s)	234
HpyCH4V	TGCA	1 cut(s)	25
HpyF10VI	GCNNNNNNNGC	1 cut(s)	31
HpyF3I	CTNAG	1 cut(s)	18
HpySE526I	ACGT	1 cut(s)	234
LmnI	GCTCC	2 cut(s)	94, 118
LweI	GCATC	1 cut(s)	14
MaeI	CTAG	1 cut(s)	189
MaeII	ACGT	1 cut(s)	234
MaeIII	GTNAC	1 cut(s)	12
MnlI	CCTC	2 cut(s)	27, 319
MseI	TTAA	1 cut(s)	239
MspI	CCGG	1 cut(s)	321
MspR9I	CCNGG	2 cut(s)	41, 116
Mva1269I	GAATGC	2 cut(s)	183, 203
MvaI	CCWGG	2 cut(s)	41, 116
MwoI	GCNNNNNNNGC	1 cut(s)	31
NlaIV	GGNNCC	1 cut(s)	120
PctI	GAATGC	2 cut(s)	183, 203
PfoI	TCCNGGA	1 cut(s)	114
PinAI	ACCGGT	1 cut(s)	320
Psp6I	CCWGG	2 cut(s)	39, 114
PspGI	CCWGG	2 cut(s)	39, 114
PspN4I	GGNNCC	1 cut(s)	120
PspPI	GGNCC	2 cut(s)	37, 318
RsaI	GTAC	1 cut(s)	346
RsaNI	GTAC	1 cut(s)	345
SaqAI	TTAA	1 cut(s)	239
Sau96I	GGNCC	2 cut(s)	37, 318
ScrFI	CCNGG	2 cut(s)	41, 116
SetI	ASST	8 cut(s)	19, 36, 45, 77, 226, 237, 274, 330
SfaNI	GCATC	1 cut(s)	14
SinI	GGWCC	2 cut(s)	37, 318
SmlI	CTYRAG	1 cut(s)	227
SmoI	CTYRAG	1 cut(s)	227
SspMI	CTAG	1 cut(s)	189
StyD4I	CCNGG	2 cut(s)	39, 114
TaaI	ACNGT	2 cut(s)	140, 162
TaiI	ACGT	1 cut(s)	237
TaqI	TCGA	2 cut(s)	132, 297
Tru1I	TTAA	1 cut(s)	239
Tru9I	TTAA	1 cut(s)	239
VpaK11BI	GGWCC	2 cut(s)	37, 318
XspI	CTAG	1 cut(s)	189

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.