MD05G1027400.v1.1

Protein of unknown function (DUF1685)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
4458014 .. 4459992
1979 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1027400.v1.1.491

Sequence Viewer

Length: 306 bp
ATGAAGCTGTCGTCAAAACAGTTTATTTCCACAATTTGGGATTCCCTAAATGTGCCGTTTACAAATGGGGAAGATAGCAAAATTCTGATTAGACTTGGAGGAAACATGGTGGTTTTAGGTTGTAGTTTGGACATTTATGCTTCTGCAATTACAAGGCCGTACCTTTCTGAAGCTTGGGAGGTTAGGGAGAAGAGGAAGATAGAGAAGCCATTGATGAATTGGAGGCTTCCTGCATTAGAGGATGAAATTGACATGAAAGACAATCTTAAATGGTGGGCTTATACTGTTGCTTCTACAGTTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.69

Weight (kDa)

7.82

Isoelectric Point (pI)

35.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 36
AcsI RAATTY 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 189
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 36
AluBI AGCT 2 cut(s) 7, 173
AluI AGCT 2 cut(s) 7, 173
AoxI GGCC 1 cut(s) 155
ApoI RAATTY 1 cut(s) 81
BceAI ACGGC 2 cut(s) 40, 142
BfmI CTRYAG 1 cut(s) 294
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 247
BseLI CCNNNNNNNGG 1 cut(s) 36
BshFI GGCC 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 36
BsnI GGCC 1 cut(s) 157
BspANI GGCC 1 cut(s) 157
Bst4CI ACNGT 3 cut(s) 21, 286, 298
Bst6I CTCTTC 1 cut(s) 185
BstF5I GGATG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 294
BsuRI GGCC 1 cut(s) 157
BtsCI GGATG 1 cut(s) 247
Csp6I GTAC 1 cut(s) 160
CviAII CATG 2 cut(s) 106, 253
CviJI RGCY 6 cut(s) 7, 157, 173, 208, 226, 278
CviKI_1 RGCY 6 cut(s) 7, 157, 173, 208, 226, 278
CviQI GTAC 1 cut(s) 160
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
Eco57I CTGAAG 1 cut(s) 189
FaeI CATG 2 cut(s) 109, 256
FaiI YATR 4 cut(s) 107, 138, 254, 282
FalI AAGNNNNNCTT 2 cut(s) 249, 281
FatI CATG 2 cut(s) 105, 252
FokI GGATG 1 cut(s) 254
HaeIII GGCC 1 cut(s) 157
Hin1II CATG 2 cut(s) 109, 256
HindIII AAGCTT 1 cut(s) 171
HinfI GANTC 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 87, 169
Hpy8I GTNNAC 1 cut(s) 60
HpyCH4III ACNGT 3 cut(s) 21, 286, 298
HpyCH4V TGCA 2 cut(s) 146, 233
Hsp92II CATG 2 cut(s) 109, 256
LpnPI CCDG 1 cut(s) 243
MboII GAAGA 3 cut(s) 83, 202, 208
MluCI AATT 5 cut(s) 33, 81, 147, 217, 246
MnlI CCTC 5 cut(s) 92, 172, 186, 216, 232
MseI TTAA 1 cut(s) 267
NlaIII CATG 2 cut(s) 109, 256
PfeI GAWTC 1 cut(s) 41
PflMI CCANNNNNTGG 1 cut(s) 36
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 267
SetI ASST 5 cut(s) 9, 121, 165, 175, 183
SfcI CTRYAG 1 cut(s) 294
SgeI CNNG 6 cut(s) 107, 118, 165, 186, 242, 265
Sse9I AATT 5 cut(s) 33, 81, 147, 217, 246
TaaI ACNGT 3 cut(s) 21, 286, 298
TasI AATT 5 cut(s) 33, 81, 147, 217, 246
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TspDTI ATGAA 4 cut(s) 17, 230, 258, 269
Van91I CCANNNNNTGG 1 cut(s) 36
XapI RAATTY 1 cut(s) 81
XcmI CCANNNNNNNNNTGG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.