MD05G1288900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
42131969 .. 42133801
1833 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1288900.v1.1.491

Sequence Viewer

Length: 147 bp
ATGAACATTGGGGTAAACGTAAAGAAATATCGAGCTATTAAGGAAGTCGGGAAGATTTTAATGAGTGTTGGGGTCATTGCCTACTTCCACCAGATGCAAGTTTGTCAGGCTGAATATTTCCGTCAGCTGCTTAAACCTGTTACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.54

Weight (kDa)

9.81

Isoelectric Point (pI)

17.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 35, 127
AluI AGCT 2 cut(s) 35, 127
ApeKI GCWGC 1 cut(s) 127
BbvI GCAGC 1 cut(s) 114
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
BmsI GCATC 1 cut(s) 84
BsaAI YACGTR 1 cut(s) 144
Bse3DI GCAATG 1 cut(s) 75
BseMI GCAATG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 114
BsrDI GCAATG 1 cut(s) 75
BstBAI YACGTR 1 cut(s) 144
BstSNI TACGTA 1 cut(s) 144
BstV1I GCAGC 1 cut(s) 114
CviJI RGCY 3 cut(s) 35, 110, 127
CviKI_1 RGCY 3 cut(s) 35, 110, 127
Eco105I TACGTA 1 cut(s) 144
Fnu4HI GCNGC 1 cut(s) 128
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 49
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4IV ACGT 2 cut(s) 18, 143
HpyCH4V TGCA 1 cut(s) 97
HpySE526I ACGT 2 cut(s) 18, 143
LpnPI CCDG 2 cut(s) 92, 104
Lsp1109I GCAGC 1 cut(s) 114
LweI GCATC 1 cut(s) 84
MaeII ACGT 2 cut(s) 18, 143
MaeIII GTNAC 1 cut(s) 139
MboII GAAGA 1 cut(s) 64
MseI TTAA 3 cut(s) 39, 59, 132
MspA1I CMGCKG 1 cut(s) 127
PkrI GCNGC 1 cut(s) 129
Ppu21I YACGTR 1 cut(s) 144
PvuII CAGCTG 1 cut(s) 127
SaqAI TTAA 3 cut(s) 39, 59, 132
SatI GCNGC 1 cut(s) 128
SetI ASST 5 cut(s) 21, 37, 129, 139, 146
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 5 cut(s) 44, 61, 103, 110, 119
SnaBI TACGTA 1 cut(s) 144
SspI AATATT 1 cut(s) 116
TaiI ACGT 2 cut(s) 21, 146
TaqI TCGA 1 cut(s) 31
Tru1I TTAA 3 cut(s) 39, 59, 132
Tru9I TTAA 3 cut(s) 39, 59, 132
TseI GCWGC 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.