Prupe.4G077000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
3752447 .. 3752754
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G077000.1

Sequence Viewer

Length: 147 bp
ATGAACATTGGGGTAACCTTTAAGAGATATCGAGCTATTAAGGAAGTTGGGAAGATTATAATGAGTGTTGGGGTTATTGCCTACTACCAACTGATGCAAGTTTGTCAGGCTGAATACTTCCGTCAGTTGCTTAAACCTGTTACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.6

Weight (kDa)

9.81

Isoelectric Point (pI)

19.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 59
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
BmsI GCATC 1 cut(s) 84
BsaAI YACGTR 1 cut(s) 144
BstBAI YACGTR 1 cut(s) 144
BstEII GGTNACC 1 cut(s) 13
BstPI GGTNACC 1 cut(s) 13
BstSNI TACGTA 1 cut(s) 144
CviJI RGCY 2 cut(s) 35, 110
CviKI_1 RGCY 2 cut(s) 35, 110
Eco105I TACGTA 1 cut(s) 144
Eco32I GATATC 1 cut(s) 29
Eco91I GGTNACC 1 cut(s) 13
EcoO65I GGTNACC 1 cut(s) 13
EcoRV GATATC 1 cut(s) 29
FaiI YATR 1 cut(s) 59
HpyCH4IV ACGT 1 cut(s) 143
HpyCH4V TGCA 1 cut(s) 97
HpySE526I ACGT 1 cut(s) 143
LpnPI CCDG 1 cut(s) 92
LweI GCATC 1 cut(s) 84
MaeII ACGT 1 cut(s) 143
MaeIII GTNAC 2 cut(s) 13, 139
MboII GAAGA 1 cut(s) 64
MseI TTAA 3 cut(s) 21, 39, 132
Ppu21I YACGTR 1 cut(s) 144
PsiI TTATAA 1 cut(s) 59
PspEI GGTNACC 1 cut(s) 13
SaqAI TTAA 3 cut(s) 21, 39, 132
SetI ASST 4 cut(s) 20, 37, 139, 146
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 3 cut(s) 44, 110, 119
SnaBI TACGTA 1 cut(s) 144
TaiI ACGT 1 cut(s) 146
TaqI TCGA 1 cut(s) 31
Tru1I TTAA 3 cut(s) 21, 39, 132
Tru9I TTAA 3 cut(s) 21, 39, 132
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.