Prupe.8G067700_v2.0.a1
BHLH Family

Transcription factor bHLH143-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
9952588 .. 9952975
388 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G067700.1

Sequence Viewer

Length: 162 bp
ATGGTGTGCCAAGGAGCAAGCCAAACAAGATTTCGGGCATTGAAACATGAAAATGGGATCGCAGGAAGACCAACAATAATAGTTAGAGTGATTGCATGCTTTCAACCTTTACAGGATTGCCAGGCTGAGTACTTTCGACATCTGCTTAAGCCTGTTACGTAG

Protein Analysis

54

Amino Acids

6.01

Weight (kDa)

9.5

Isoelectric Point (pI)

29.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AfaI GTAC 1 cut(s) 131
AflII CTTAAG 1 cut(s) 146
AgsI TTSAA 2 cut(s) 43, 104
AjnI CCWGG 1 cut(s) 120
AjuI GAANNNNNNNTTGG 2 cut(s) 15, 47
AlwI GGATC 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 122
BfrI CTTAAG 1 cut(s) 146
BmcAI AGTACT 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 122
BpiI GAAGAC 1 cut(s) 73
BsaAI YACGTR 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 10
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 117
Bsp143I GATC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 118
BspPI GGATC 1 cut(s) 65
BspTI CTTAAG 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 10
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 122
BstAFI CTTAAG 1 cut(s) 146
BstBAI YACGTR 1 cut(s) 159
BstC8I GCNNGC 2 cut(s) 19, 97
BstDEI CTNAG 1 cut(s) 126
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 120
BstSNI TACGTA 1 cut(s) 159
BstV2I GAAGAC 1 cut(s) 73
Cac8I GCNNGC 2 cut(s) 19, 97
Csp6I GTAC 1 cut(s) 130
CviAII CATG 2 cut(s) 47, 96
CviJI RGCY 3 cut(s) 21, 125, 151
CviKI_1 RGCY 3 cut(s) 21, 125, 151
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eco105I TACGTA 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 10
FaeI CATG 2 cut(s) 50, 99
FaiI YATR 2 cut(s) 48, 97
FatI CATG 2 cut(s) 46, 95
Hin1II CATG 2 cut(s) 50, 99
HpyCH4IV ACGT 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 158
Hsp92II CATG 2 cut(s) 50, 99
Kzo9I GATC 1 cut(s) 57
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 4 cut(s) 48, 98, 107, 134
MaeII ACGT 1 cut(s) 158
MaeIII GTNAC 1 cut(s) 154
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 1 cut(s) 78
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 51
MspCI CTTAAG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
NdeII GATC 1 cut(s) 57
NlaIII CATG 2 cut(s) 50, 99
NspI RCATGY 1 cut(s) 99
PaeI GCATGC 1 cut(s) 99
Ppu21I YACGTR 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 57
ScaI AGTACT 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 122
SetI ASST 2 cut(s) 109, 161
SmiMI CAYNNNNRTG 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
SnaBI TACGTA 1 cut(s) 159
SphI GCATGC 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 120
StyI CCWWGG 1 cut(s) 10
TaiI ACGT 1 cut(s) 161
TaqI TCGA 1 cut(s) 136
TatI WGTACW 1 cut(s) 129
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 63
Vha464I CTTAAG 1 cut(s) 146
XceI RCATGY 1 cut(s) 99
ZrmI AGTACT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.