Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr10

Orthogroup ID

OG0003125

Physical Location & Seq

Genomic Coordinates Reverse (-)

35860203 .. 35862194

Gene Structure 1992 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD10G1265000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 147 bp

ATGAACATTGGGGTAAACGTAAAGAAATATCGAGCTATAAAGGAAGTTGGGAAGATTTTAATGAGTGTTGGGGTAATTGCCTACTCTCACCAGATGCAAGTTTGTCAGGCTGAATATTTCCGTCAGTTGCTTAAACCTGTTACGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

49

Amino Acids

5.48

Weight (kDa)

9.81

Isoelectric Point (pI)

17.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003125)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G50010
fragaria_vesca	FvH4_5g35810
malus_domestica	MD04G1047500.v1.1 MD05G1288900.v1.1 MD08G1192900.v1.1 MD08G1193000.v1.1 MD10G1265000.v1.1 MD15G1381700.v1.1 MD15G1381800.v1.1
prunus_persica	Prupe.1G527600_v2.0.a1 Prupe.1G527700_v2.0.a1 Prupe.4G077000_v2.0.a1 Prupe.8G067700_v2.0.a1
pyrus_communis	pycom08g16640 pycom15g34180
rosa_chinensis	RchiOBHm_Chr5g0013401 RchiOBHm_Chr7g0237501 RchiOBHm_Chr7g0237511
rosa_laevigata	RLG00000000997
rosa_multiflora	Rmu_co8283291.1_g000001 Rmu_sc0013113.1_g000010
rosa_roxburghii	Rroxscaffold_3G00224070 Rroxscaffold_3G00224080
rosa_rugosa	Rorug02G0445800 Rorug02G0445800 Rorug02G0445800 Rorug04G0381500 Rorug06G0077400 Rorug07G0074000 Rorug07G0303700
rosa_samantha	Rh6BG229200 Rh7AG461300 Rh7BG431500 Rh7CG478600 Rh7DG447800
rosa_wichuraiana	Rw7G038170 Rw7G038180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	1 cut(s)	35
AluI	AGCT	1 cut(s)	35
AsuHPI	GGTGA	1 cut(s)	80
BmsI	GCATC	1 cut(s)	84
BsaAI	YACGTR	1 cut(s)	144
BstBAI	YACGTR	1 cut(s)	144
BstSNI	TACGTA	1 cut(s)	144
CviJI	RGCY	2 cut(s)	35, 110
CviKI_1	RGCY	2 cut(s)	35, 110
Eco105I	TACGTA	1 cut(s)	144
FaiI	YATR	1 cut(s)	38
HphI	GGTGA	1 cut(s)	80
Hpy166II	GTNNAC	1 cut(s)	16
Hpy8I	GTNNAC	1 cut(s)	16
HpyCH4IV	ACGT	2 cut(s)	18, 143
HpyCH4V	TGCA	1 cut(s)	97
HpySE526I	ACGT	2 cut(s)	18, 143
LpnPI	CCDG	2 cut(s)	92, 104
LweI	GCATC	1 cut(s)	84
MaeII	ACGT	2 cut(s)	18, 143
MaeIII	GTNAC	1 cut(s)	139
MboII	GAAGA	1 cut(s)	64
MluCI	AATT	1 cut(s)	75
MseI	TTAA	2 cut(s)	59, 132
Ppu21I	YACGTR	1 cut(s)	144
SaqAI	TTAA	2 cut(s)	59, 132
SetI	ASST	4 cut(s)	21, 37, 139, 146
SfaNI	GCATC	1 cut(s)	84
SgeI	CNNG	4 cut(s)	44, 103, 110, 119
SnaBI	TACGTA	1 cut(s)	144
Sse9I	AATT	1 cut(s)	75
SspI	AATATT	1 cut(s)	116
TaiI	ACGT	2 cut(s)	21, 146
TaqI	TCGA	1 cut(s)	31
TasI	AATT	1 cut(s)	75
Tru1I	TTAA	2 cut(s)	59, 132
Tru9I	TTAA	2 cut(s)	59, 132
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.