MD08G1218500.v1.1

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
28085346 .. 28086001
656 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1218500.v1.1.491

Sequence Viewer

Length: 177 bp
ATGCAGGTTGATGGCCCAGCAGAAAAGAAATCCGTGCCGGAGCCTTCTTTTGAGATTTTAACCAACCCTTCTAGGGTGGTTCCTTCTCAGGAGAAGTACATCAAATTTCCGGAAGAAAGTAGATACGTGCCCATTAAGTTAGCGCCTTCGGGGTTTGTTCTCTTGAGAGACCTGTGA

Protein Analysis

59

Amino Acids

6.56

Weight (kDa)

6.17

Isoelectric Point (pI)

70.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPN2_C PF18004 7 - 57 4.9e-15 26S proteasome regulatory subunit RPN2 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 109
AcsI RAATTY 1 cut(s) 104
AfaI GTAC 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 162
Aor13HI TCCGGA 1 cut(s) 109
AoxI GGCC 1 cut(s) 13
ApoI RAATTY 1 cut(s) 104
AspLEI GCGC 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 14
BaeGI GKGCMC 1 cut(s) 132
BccI CCATC 1 cut(s) 5
BcoDI GTCTC 1 cut(s) 162
BfaI CTAG 1 cut(s) 72
BfoI RGCGCY 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 14
BmiI GGNNCC 2 cut(s) 42, 81
BsaAI YACGTR 1 cut(s) 127
BsaI GGTCTC 1 cut(s) 162
BsaWI WCCGGW 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 73
BseAI TCCGGA 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 101
BseSI GKGCMC 1 cut(s) 132
BseYI CCCAGC 1 cut(s) 16
BshFI GGCC 1 cut(s) 15
BsiSI CCGG 2 cut(s) 38, 110
BslI CCNNNNNNNGG 1 cut(s) 73
BsmAI GTCTC 1 cut(s) 162
BsnI GGCC 1 cut(s) 15
Bso31I GGTCTC 1 cut(s) 162
Bsp1286I GDGCHC 1 cut(s) 132
Bsp13I TCCGGA 1 cut(s) 109
BspANI GGCC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 100
BspEI TCCGGA 1 cut(s) 109
BspLI GGNNCC 2 cut(s) 42, 81
BspTNI GGTCTC 1 cut(s) 162
BstBAI YACGTR 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 87
BstH2I RGCGCY 1 cut(s) 146
BstHHI GCGC 1 cut(s) 145
BstMAI GTCTC 1 cut(s) 162
BstSLI GKGCMC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 15
CfoI GCGC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 2 cut(s) 15, 43
CviKI_1 RGCY 2 cut(s) 15, 43
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 87
Eco31I GGTCTC 1 cut(s) 162
FspBI CTAG 1 cut(s) 72
GlaI GCGC 1 cut(s) 144
GsaI CCCAGC 1 cut(s) 20
HaeII RGCGCY 1 cut(s) 146
HaeIII GGCC 1 cut(s) 15
HapII CCGG 2 cut(s) 38, 110
HhaI GCGC 1 cut(s) 145
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HpaII CCGG 2 cut(s) 38, 110
Hpy188III TCNNGA 3 cut(s) 89, 110, 163
HpyAV CCTTC 4 cut(s) 54, 78, 93, 156
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 126
HspAI GCGC 1 cut(s) 143
Kpn2I TCCGGA 1 cut(s) 109
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 4 cut(s) 30, 51, 74, 123
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 126
MboII GAAGA 1 cut(s) 125
MhlI GDGCHC 1 cut(s) 132
MluCI AATT 1 cut(s) 104
MroI TCCGGA 1 cut(s) 109
MseI TTAA 2 cut(s) 59, 135
MspI CCGG 2 cut(s) 38, 110
NlaIV GGNNCC 2 cut(s) 42, 81
Ppu21I YACGTR 1 cut(s) 127
PspFI CCCAGC 1 cut(s) 16
PspN4I GGNNCC 2 cut(s) 42, 81
PspPI GGNCC 1 cut(s) 14
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 59, 135
Sau96I GGNCC 1 cut(s) 14
SduI GDGCHC 1 cut(s) 132
SetI ASST 3 cut(s) 9, 129, 174
SgeI CNNG 9 cut(s) 17, 29, 46, 50, 84, 101, 122, 139, 162
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
Sse9I AATT 1 cut(s) 104
SspMI CTAG 1 cut(s) 72
TaiI ACGT 1 cut(s) 129
TasI AATT 1 cut(s) 104
TatI WGTACW 1 cut(s) 96
Tru1I TTAA 2 cut(s) 59, 135
Tru9I TTAA 2 cut(s) 59, 135
TspGWI ACGGA 1 cut(s) 22
XapI RAATTY 1 cut(s) 104
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.