RchiOBHm_Chr6g0269091

26S proteasome non-ATPase regulatory subunit 1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
26318404 .. 26318601
198 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24137

Sequence Viewer

Length: 198 bp
ATGTCGCTTGCAAAACCATCTCTGTTTGACTATCCTAAACCTTGTCCTGTGCCAGTGGAGTCTGAGCCTTCTTTTGCTATTTTAACCAACCCATCTAGGGTGCTGCCAGCCCAAGAAAAATACATCTGGTTTTTGGAAGGAAGTAGATATCTTCCTATCAGGCCGTCGTCTACGGATTTTGTATTACTGAGGGACTAG

Protein Analysis

65

Amino Acids

7.41

Weight (kDa)

6.15

Isoelectric Point (pI)

74.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPN2_C PF18004 19 - 65 3.5e-11 26S proteasome regulatory subunit RPN2 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 97
AoxI GGCC 1 cut(s) 161
ApeKI GCWGC 1 cut(s) 103
BbvI GCAGC 1 cut(s) 90
BccI CCATC 2 cut(s) 25, 100
BceAI ACGGC 1 cut(s) 148
BfaI CTAG 2 cut(s) 96, 196
BisI GCNGC 1 cut(s) 104
BlsI GCNGC 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse1I ACTGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 97
BseMII CTCAG 2 cut(s) 54, 179
BseNI ACTGG 1 cut(s) 53
BseXI GCAGC 1 cut(s) 90
BshFI GGCC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 97
BsnI GGCC 1 cut(s) 163
BspANI GGCC 1 cut(s) 163
BspCNI CTCAG 2 cut(s) 55, 180
BsrI ACTGG 1 cut(s) 53
BstC8I GCNNGC 2 cut(s) 9, 108
BstDEI CTNAG 2 cut(s) 63, 188
BstV1I GCAGC 1 cut(s) 90
BsuRI GGCC 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 60
Cac8I GCNNGC 2 cut(s) 9, 108
CviJI RGCY 3 cut(s) 67, 110, 163
CviKI_1 RGCY 3 cut(s) 67, 110, 163
DdeI CTNAG 2 cut(s) 63, 188
Eco32I GATATC 1 cut(s) 149
EcoRV GATATC 1 cut(s) 149
FblI GTMKAC 1 cut(s) 170
Fnu4HI GCNGC 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 104
FspBI CTAG 2 cut(s) 96, 196
GluI GCNGC 1 cut(s) 104
HaeIII GGCC 1 cut(s) 163
HinfI GANTC 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 171
Hpy188I TCNGA 1 cut(s) 64
Hpy8I GTNNAC 1 cut(s) 171
Hpy99I CGWCG 1 cut(s) 169
HpyAV CCTTC 2 cut(s) 78, 131
HpyCH4V TGCA 1 cut(s) 11
HpyF3I CTNAG 2 cut(s) 63, 188
LpnPI CCDG 5 cut(s) 60, 66, 112, 120, 145
Lsp1109I GCAGC 1 cut(s) 90
MaeI CTAG 2 cut(s) 96, 196
MboII GAAGA 1 cut(s) 143
MlyI GAGTC 1 cut(s) 68
MnlI CCTC 1 cut(s) 183
MseI TTAA 1 cut(s) 83
PkrI GCNGC 1 cut(s) 105
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
SaqAI TTAA 1 cut(s) 83
SatI GCNGC 1 cut(s) 104
SchI GAGTC 1 cut(s) 68
SetI ASST 1 cut(s) 43
SgeI CNNG 9 cut(s) 20, 54, 59, 65, 108, 119, 125, 139, 172
SspMI CTAG 2 cut(s) 96, 196
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TscAI CASTG 1 cut(s) 60
TseI GCWGC 1 cut(s) 103
TspGWI ACGGA 1 cut(s) 188
TspRI CASTG 1 cut(s) 60
XmiI GTMKAC 1 cut(s) 170
XspI CTAG 2 cut(s) 96, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.