MD09G1106200.v1.1

APO protein 4

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0002143
Physical Location & Seq
Reverse (-)
7688193 .. 7688885
693 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1106200.v1.1.491

Sequence Viewer

Length: 132 bp
ATGCAAGGTGTTTCTACTCTCCTCAAAATGGTACCAGTTTTGGCCTGCAAGTTCTGTCTAGAAGTATATATAGGTGAGAAAGGCCACTTAATTCAGACTTGTTGTGGCTTCAAACGTCGTGGCAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
APO_RNA-bind

Protein Analysis

44

Amino Acids

4.8

Weight (kDa)

9.38

Isoelectric Point (pI)

45.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
APO_RNA-bind PF05634 2 - 39 3.9e-09 APO RNA-binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 31
AccB1I GGYRCC 1 cut(s) 31
AfaI GTAC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 112
AoxI GGCC 2 cut(s) 42, 82
Asp718I GGTACC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 86
BanI GGYRCC 1 cut(s) 31
BfaI CTAG 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse1I ACTGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 28
BseNI ACTGG 1 cut(s) 35
BseRI GAGGAG 1 cut(s) 11
BshFI GGCC 2 cut(s) 44, 84
BshNI GGYRCC 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 28
BsnI GGCC 2 cut(s) 44, 84
BspANI GGCC 2 cut(s) 44, 84
BspLI GGNNCC 1 cut(s) 33
BspT107I GGYRCC 1 cut(s) 31
BsrI ACTGG 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 46
BsuRI GGCC 2 cut(s) 44, 84
Cac8I GCNNGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 32
CspCI CAANNNNNGTGG 1 cut(s) 100
CviJI RGCY 3 cut(s) 44, 84, 108
CviKI_1 RGCY 3 cut(s) 44, 84, 108
CviQI GTAC 1 cut(s) 32
FaiI YATR 3 cut(s) 67, 69, 71
FspBI CTAG 1 cut(s) 59
HaeIII GGCC 2 cut(s) 44, 84
HphI GGTGA 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 59
Hpy99I CGWCG 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 4, 48
HpySE526I ACGT 1 cut(s) 115
KpnI GGTACC 1 cut(s) 35
LpnPI CCDG 2 cut(s) 48, 58
MaeI CTAG 1 cut(s) 59
MaeII ACGT 1 cut(s) 115
MluCI AATT 2 cut(s) 90, 127
MnlI CCTC 1 cut(s) 32
MseI TTAA 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 33
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
SaqAI TTAA 1 cut(s) 89
SetI ASST 3 cut(s) 10, 76, 118
SgeI CNNG 6 cut(s) 17, 47, 57, 61, 71, 111
Sse9I AATT 2 cut(s) 90, 127
SspMI CTAG 1 cut(s) 59
TaiI ACGT 1 cut(s) 118
TasI AATT 2 cut(s) 90, 127
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
XbaI TCTAGA 1 cut(s) 58
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.