MD09G1109700.v1.1

2-alkenal reductase (NADP( )-dependent)-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0003278
Physical Location & Seq
Forward (+)
8126805 .. 8128118
1314 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1109700.v1.1.491

Sequence Viewer

Length: 507 bp
ATGATTATCATTCATTTTTTCATTGAAAATATTTCTATTAGGGTGAGGCTAATCAAGGAGGAATTTGGATATGATGATGCTTTTAACTACCACACAGACACAGATTTTGATGCTGCTTTAAGCAAGTATTTCCCTAATGGAATCGATGTCTACCTTGACAATGTTGGCGGTGAAATGCTTGAGGCTGCTCTCAACCATGTCAACAAGCATGCCAAGGTCCCTCTTTGTGGCATGATATCTGGCTACAATAAGGTTTGGACTGAGAGAGAGGGGGTGAGGAATCTGTTGAATTTAATCGGAAAGGAGGTGAATATGCAAGGGTTCATGGTGGGTTCATACCTGCATCGTCTTGGAGATTTTGCAACCGAGATGGAGAGCCACCTAAAGCAAGGCAAGATTGGTTATTCTAAGCTCAAAATCTTCCATGGAATTGAGACATTCTTGGAAAGTTTGGGGTCCCTCTTCACCAGCTCTAATGTTGGAAAAGTTGTAATCCAAGTCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ADH_N_2 ADH_zinc_N

Protein Analysis

169

Amino Acids

19.01

Weight (kDa)

6.15

Isoelectric Point (pI)

20.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_zinc_N PF00107 15 - 114 1.4e-13 Zinc-binding dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 348
AccI GTMKAC 1 cut(s) 150
AciI CCGC 1 cut(s) 168
AcsI RAATTY 2 cut(s) 62, 289
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 2 cut(s) 26, 289
AluBI AGCT 2 cut(s) 412, 471
AluI AGCT 2 cut(s) 412, 471
Alw26I GTCTC 1 cut(s) 428
ApeKI GCWGC 2 cut(s) 113, 185
ApoI RAATTY 2 cut(s) 62, 289
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
AspS9I GGNCC 2 cut(s) 217, 456
AsuHPI GGTGA 5 cut(s) 55, 182, 286, 319, 457
AvaII GGWCC 2 cut(s) 217, 456
BbvI GCAGC 2 cut(s) 100, 172
BccI CCATC 1 cut(s) 364
BcoDI GTCTC 1 cut(s) 428
BfuAI ACCTGC 1 cut(s) 348
BisI GCNGC 2 cut(s) 114, 186
BlsI GCNGC 2 cut(s) 115, 187
Bme18I GGWCC 2 cut(s) 217, 456
BmgT120I GGNCC 2 cut(s) 217, 456
BmiI GGNNCC 3 cut(s) 219, 457, 458
BmsI GCATC 3 cut(s) 67, 100, 352
BpuEI CTTGAG 1 cut(s) 200
Bsa29I ATCGAT 1 cut(s) 144
BsaJI CCNNGG 2 cut(s) 213, 424
Bsc4I CCNNNNNNNGG 1 cut(s) 227
BseCI ATCGAT 1 cut(s) 144
BseDI CCNNGG 2 cut(s) 213, 424
BseLI CCNNNNNNNGG 1 cut(s) 227
BseMII CTCAG 1 cut(s) 252
BseXI GCAGC 2 cut(s) 100, 172
BshVI ATCGAT 1 cut(s) 144
BslFI GGGAC 2 cut(s) 203, 442
BslI CCNNNNNNNGG 1 cut(s) 227
BsmAI GTCTC 1 cut(s) 428
BsmFI GGGAC 2 cut(s) 203, 442
Bsp19I CCATGG 1 cut(s) 424
BspACI CCGC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 253
BspDI ATCGAT 1 cut(s) 144
BspLI GGNNCC 3 cut(s) 219, 457, 458
BspMI ACCTGC 1 cut(s) 348
BssECI CCNNGG 2 cut(s) 213, 424
BssT1I CCWWGG 2 cut(s) 213, 424
Bst6I CTCTTC 1 cut(s) 467
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 261, 408
BstDSI CCRYGG 1 cut(s) 424
BstMAI GTCTC 1 cut(s) 428
BstNSI RCATGY 1 cut(s) 212
BstV1I GCAGC 2 cut(s) 100, 172
Bsu15I ATCGAT 1 cut(s) 144
BsuTUI ATCGAT 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 424
BveI ACCTGC 1 cut(s) 348
Cac8I GCNNGC 1 cut(s) 210
Cfr13I GGNCC 2 cut(s) 217, 456
ClaI ATCGAT 1 cut(s) 144
CviAII CATG 5 cut(s) 197, 209, 232, 325, 425
CviJI RGCY 6 cut(s) 49, 185, 243, 378, 412, 471
CviKI_1 RGCY 6 cut(s) 49, 185, 243, 378, 412, 471
DdeI CTNAG 2 cut(s) 261, 408
Eam1104I CTCTTC 1 cut(s) 467
EarI CTCTTC 1 cut(s) 467
Eco130I CCWWGG 2 cut(s) 213, 424
Eco32I GATATC 1 cut(s) 237
Eco47I GGWCC 2 cut(s) 217, 456
EcoO109I RGGNCCY 2 cut(s) 217, 456
EcoRV GATATC 1 cut(s) 237
EcoT14I CCWWGG 2 cut(s) 213, 424
ErhI CCWWGG 2 cut(s) 213, 424
FaeI CATG 5 cut(s) 200, 212, 235, 328, 428
FaiI YATR 8 cut(s) 72, 198, 210, 233, 314, 326, 337, 426
FaqI GGGAC 2 cut(s) 203, 442
FatI CATG 5 cut(s) 196, 208, 231, 324, 424
FblI GTMKAC 1 cut(s) 150
Fnu4HI GCNGC 2 cut(s) 114, 186
Fsp4HI GCNGC 2 cut(s) 114, 186
GluI GCNGC 2 cut(s) 114, 186
Hin1II CATG 5 cut(s) 200, 212, 235, 328, 428
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 2 cut(s) 141, 280
HphI GGTGA 5 cut(s) 55, 182, 286, 319, 457
Hpy166II GTNNAC 2 cut(s) 151, 202
Hpy188I TCNGA 1 cut(s) 299
Hpy8I GTNNAC 2 cut(s) 151, 202
HpyCH4V TGCA 3 cut(s) 316, 343, 362
HpyF3I CTNAG 2 cut(s) 261, 408
Hsp92II CATG 5 cut(s) 200, 212, 235, 328, 428
KflI GGGWCCC 1 cut(s) 456
LpnPI CCDG 3 cut(s) 225, 353, 481
Lsp1109I GCAGC 2 cut(s) 100, 172
LweI GCATC 3 cut(s) 67, 100, 352
MboII GAAGA 2 cut(s) 412, 454
MluCI AATT 3 cut(s) 62, 289, 429
MmeI TCCRAC 1 cut(s) 460
MnlI CCTC 8 cut(s) 39, 52, 175, 231, 262, 270, 298, 470
MseI TTAA 3 cut(s) 84, 119, 293
NcoI CCATGG 1 cut(s) 424
NlaIII CATG 5 cut(s) 200, 212, 235, 328, 428
NlaIV GGNNCC 3 cut(s) 219, 457, 458
NspI RCATGY 1 cut(s) 212
PaeI GCATGC 1 cut(s) 212
PfeI GAWTC 2 cut(s) 141, 280
PkrI GCNGC 2 cut(s) 115, 187
PpuMI RGGWCCY 2 cut(s) 217, 456
Psp5II RGGWCCY 2 cut(s) 217, 456
PspN4I GGNNCC 3 cut(s) 219, 457, 458
PspPI GGNCC 2 cut(s) 217, 456
PspPPI RGGWCCY 2 cut(s) 217, 456
SaqAI TTAA 3 cut(s) 84, 119, 293
SatI GCNGC 2 cut(s) 114, 186
Sau96I GGNCC 2 cut(s) 217, 456
SetI ASST 8 cut(s) 156, 219, 255, 309, 342, 384, 414, 473
SfaNI GCATC 3 cut(s) 67, 100, 352
SinI GGWCC 2 cut(s) 217, 456
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
SphI GCATGC 1 cut(s) 212
Sse9I AATT 3 cut(s) 62, 289, 429
SsiI CCGC 1 cut(s) 168
SspI AATATT 1 cut(s) 31
StyI CCWWGG 2 cut(s) 213, 424
TaqI TCGA 1 cut(s) 144
TasI AATT 3 cut(s) 62, 289, 429
TfiI GAWTC 2 cut(s) 141, 280
Tru1I TTAA 3 cut(s) 84, 119, 293
Tru9I TTAA 3 cut(s) 84, 119, 293
TseI GCWGC 2 cut(s) 113, 185
TspDTI ATGAA 3 cut(s) 10, 313, 324
VpaK11BI GGWCC 2 cut(s) 217, 456
XapI RAATTY 2 cut(s) 62, 289
XceI RCATGY 1 cut(s) 212
XmiI GTMKAC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.