Rh2AG541000

2-alkenal reductase (NADP( )-dependent)-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
76852142 .. 76852644
503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG541000.1

Sequence Viewer

Length: 273 bp
ATGATATCTGGCTACAACAAGGTATGGACTGAGAGGGAGGGAGTGAGGAATCTGCTGAATCTGATCGGCAAACAAGTGAAGATGCAAGGGTACATGGTGGATTCATACTTTGATCGTTTTGGAGATTTTGCAAAGGAGATGGAGAGCCATCTAAAGGAAGGCAAGATTGTTTCTAAGATCAAAATCGTCCATGGAGTTGAAAATTTCTTGGAGAGCTTAGGGTCACTGTTTACCAGCTCAAATATTGGGAAAGTAGTAATCCAAGTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.24

Weight (kDa)

9.26

Isoelectric Point (pI)

17.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 202
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 200
AluBI AGCT 2 cut(s) 216, 237
AluI AGCT 2 cut(s) 216, 237
ApoI RAATTY 1 cut(s) 202
BccI CCATC 2 cut(s) 133, 156
BmsI GCATC 1 cut(s) 72
Bpu10I CCTNAGC 1 cut(s) 217
BsaBI GATNNNNATC 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 190
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse8I GATNNNNATC 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 190
BseJI GATNNNNATC 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 154
Bsp143I GATC 3 cut(s) 63, 112, 177
Bsp19I CCATGG 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 190
BssMI GATC 3 cut(s) 63, 112, 177
BssT1I CCWWGG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 228
BstDEI CTNAG 3 cut(s) 30, 174, 217
BstDSI CCRYGG 1 cut(s) 190
BstKTI GATC 3 cut(s) 66, 115, 180
BstMBI GATC 3 cut(s) 63, 112, 177
BtgI CCRYGG 1 cut(s) 190
BtsIMutI CAGTG 1 cut(s) 224
Csp6I GTAC 1 cut(s) 91
CviAII CATG 2 cut(s) 94, 191
CviJI RGCY 4 cut(s) 12, 147, 216, 237
CviKI_1 RGCY 4 cut(s) 12, 147, 216, 237
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 3 cut(s) 30, 174, 217
DpnI GATC 3 cut(s) 65, 114, 179
DpnII GATC 3 cut(s) 63, 112, 177
Eco130I CCWWGG 1 cut(s) 190
Eco32I GATATC 1 cut(s) 6
EcoRV GATATC 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 190
ErhI CCWWGG 1 cut(s) 190
FaeI CATG 2 cut(s) 97, 194
FaiI YATR 4 cut(s) 25, 95, 106, 192
FatI CATG 2 cut(s) 93, 190
Hin1II CATG 2 cut(s) 97, 194
HinfI GANTC 3 cut(s) 49, 58, 101
Hpy166II GTNNAC 1 cut(s) 231
Hpy188I TCNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 231
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4V TGCA 2 cut(s) 85, 131
HpyF3I CTNAG 3 cut(s) 30, 174, 217
Hsp92II CATG 2 cut(s) 97, 194
Kzo9I GATC 3 cut(s) 63, 112, 177
LpnPI CCDG 1 cut(s) 247
LweI GCATC 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 222
MalI GATC 3 cut(s) 65, 114, 179
MboI GATC 3 cut(s) 63, 112, 177
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 202
MnlI CCTC 3 cut(s) 27, 31, 39
NcoI CCATGG 1 cut(s) 190
NdeII GATC 3 cut(s) 63, 112, 177
NlaIII CATG 2 cut(s) 97, 194
NmuCI GTSAC 1 cut(s) 222
PfeI GAWTC 3 cut(s) 49, 58, 101
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
Sau3AI GATC 3 cut(s) 63, 112, 177
SetI ASST 3 cut(s) 24, 218, 239
SfaNI GCATC 1 cut(s) 72
SgeI CNNG 9 cut(s) 21, 31, 86, 98, 106, 175, 203, 220, 246
Sse9I AATT 1 cut(s) 202
SspI AATATT 1 cut(s) 244
StyI CCWWGG 1 cut(s) 190
TaaI ACNGT 1 cut(s) 228
TasI AATT 1 cut(s) 202
TfiI GAWTC 3 cut(s) 49, 58, 101
TscAI CASTG 1 cut(s) 231
TseFI GTSAC 1 cut(s) 222
Tsp45I GTSAC 1 cut(s) 222
TspDTI ATGAA 1 cut(s) 93
TspRI CASTG 1 cut(s) 231
XapI RAATTY 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.