MD15G1176300.v1.1

Early nodulin-93-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
13762812 .. 13763114
303 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1176300.v1.1.491

Sequence Viewer

Length: 168 bp
ATGCTGCCTTGGGCTAGAGCCAATCTCAATCCCACCGCTCAGGCCCTCATAATCTCCACAGTGGCTGGAATGGCATACTTTATCGTGGCGGAAAAGACTGTTTTGGCAACTGCAAGAAGGAACTCATTCAATCAAGTGGCTTACCATGAAGCCTGCGTTCATCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.07

Weight (kDa)

9.19

Isoelectric Point (pI)

29.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ENOD93 PF03386 1 - 42 1.8e-21 Early nodulin 93 ENOD93 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 38
AciI CCGC 2 cut(s) 36, 89
AgsI TTSAA 1 cut(s) 130
AlwNI CAGNNNCTG 1 cut(s) 65
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 4
Asp700I GAANNNNTTC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 43
BfaI CTAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 43
BplI GAGNNNNNCTC 2 cut(s) 9, 41
Bpu10I CCTNAGC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 8
BseDI CCNNGG 1 cut(s) 8
BseMII CTCAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 44
BsnI GGCC 1 cut(s) 44
BspACI CCGC 2 cut(s) 36, 89
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 52
BsrBI CCGCTC 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 8
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 2 cut(s) 61, 100
BstC8I GCNNGC 1 cut(s) 154
BstDEI CTNAG 1 cut(s) 39
BstMWI GCNNNNNNNGC 1 cut(s) 71
BsuRI GGCC 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 154
CaiI CAGNNNCTG 1 cut(s) 65
Cfr13I GGNCC 1 cut(s) 43
CviAII CATG 1 cut(s) 146
CviJI RGCY 6 cut(s) 14, 20, 44, 65, 140, 152
CviKI_1 RGCY 6 cut(s) 14, 20, 44, 65, 140, 152
DdeI CTNAG 1 cut(s) 39
EciI GGCGGA 1 cut(s) 104
Eco130I CCWWGG 1 cut(s) 8
EcoO109I RGGNCCY 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 1 cut(s) 149
FaiI YATR 3 cut(s) 50, 76, 147
FatI CATG 1 cut(s) 145
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 15
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 111
HpyCH4III ACNGT 2 cut(s) 61, 100
HpyCH4V TGCA 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 1 cut(s) 149
LpnPI CCDG 2 cut(s) 26, 51
MaeI CTAG 1 cut(s) 15
MbiI CCGCTC 1 cut(s) 38
MnlI CCTC 1 cut(s) 56
MroXI GAANNNNTTC 1 cut(s) 125
MwoI GCNNNNNNNGC 1 cut(s) 71
NlaIII CATG 1 cut(s) 149
PdmI GAANNNNTTC 1 cut(s) 125
PkrI GCNGC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 43
PstNI CAGNNNCTG 1 cut(s) 65
SatI GCNGC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 43
SgeI CNNG 8 cut(s) 21, 27, 53, 78, 97, 126, 146, 158
SsiI CCGC 2 cut(s) 36, 89
SspMI CTAG 1 cut(s) 15
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 2 cut(s) 61, 100
TscAI CASTG 1 cut(s) 66
TseI GCWGC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 149, 162
TspRI CASTG 1 cut(s) 66
XmnI GAANNNNTTC 1 cut(s) 125
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.