Rh6DG465200

Early nodulin-93-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
63327679 .. 63328930
1252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG465200.1

Sequence Viewer

Length: 360 bp
ATGGGAATTCCATCGGAAATGAGGGACATGTGGGTGAACAGCCGTCGAAACTCTCTGCTGATTCCTTCGCCATATGAAGATGAGATTCAACAGAAGGCCTTAAGGGCCAAAACTTGCACCCAAGAGGGCGCTCGCCAGGGATTCAAGGCAGCTTGCATTTGGGGTGCTGTCAGCGCTGTGCCTACATTGGCTGCTGTTCGTACGATTCCTTGGGCAAAGGCTAACCTCAATTATACTGCTCAAGCACTGATGATATCTGCTGCATCAATTGCTGCTTACTTCATCACCGCTGATAAAACTATCTTGGAGTGTGCTAGAAAAAATGCGCAGTTGCAACAAGCCTTGAGCCGCCAGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

13.1

Weight (kDa)

9.6

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ENOD93 PF03386 33 - 108 6.7e-37 Early nodulin 93 ENOD93 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 327
AciI CCGC 2 cut(s) 288, 349
AcsI RAATTY 1 cut(s) 6
AfaI GTAC 1 cut(s) 202
AfeI AGCGCT 1 cut(s) 175
AflII CTTAAG 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 27
AgsI TTSAA 2 cut(s) 89, 145
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
Aor51HI AGCGCT 1 cut(s) 175
AoxI GGCC 2 cut(s) 96, 105
ApeKI GCWGC 4 cut(s) 149, 191, 260, 272
ApoI RAATTY 1 cut(s) 6
AspLEI GCGC 3 cut(s) 131, 176, 328
AspS9I GGNCC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 46, 277
BbvI GCAGC 4 cut(s) 161, 178, 247, 259
BccI CCATC 1 cut(s) 19
BceAI ACGGC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 1 cut(s) 315
BfoI RGCGCY 2 cut(s) 132, 177
BfrI CTTAAG 1 cut(s) 100
BglI GCCNNNNNGGC 1 cut(s) 104
BisI GCNGC 5 cut(s) 150, 192, 261, 273, 349
BlsI GCNGC 5 cut(s) 151, 193, 262, 274, 350
Bme1390I CCNGG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 137
BmsI GCATC 1 cut(s) 272
BpuEI CTTGAG 1 cut(s) 225
BsaJI CCNNGG 2 cut(s) 136, 209
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 2 cut(s) 136, 209
BseXI GCAGC 4 cut(s) 161, 178, 247, 259
BshFI GGCC 2 cut(s) 98, 107
BsiWI CGTACG 1 cut(s) 200
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
BsnI GGCC 2 cut(s) 98, 107
BspACI CCGC 2 cut(s) 288, 349
BspANI GGCC 2 cut(s) 98, 107
BspTI CTTAAG 1 cut(s) 100
BssECI CCNNGG 2 cut(s) 136, 209
BssT1I CCWWGG 1 cut(s) 209
Bst2UI CCWGG 1 cut(s) 137
BstAFI CTTAAG 1 cut(s) 100
BstAPI GCANNNNNTGC 1 cut(s) 269
BstC8I GCNNGC 3 cut(s) 133, 154, 353
BstH2I RGCGCY 2 cut(s) 132, 177
BstHHI GCGC 3 cut(s) 131, 176, 328
BstMWI GCNNNNNNNGC 3 cut(s) 104, 173, 269
BstNI CCWGG 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 135
BstV1I GCAGC 4 cut(s) 161, 178, 247, 259
BsuRI GGCC 2 cut(s) 98, 107
BtsIMutI CAGTG 1 cut(s) 245
Cac8I GCNNGC 3 cut(s) 133, 154, 353
CfoI GCGC 3 cut(s) 131, 176, 328
Cfr13I GGNCC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 201
CviAII CATG 1 cut(s) 28
CviJI RGCY 8 cut(s) 42, 98, 107, 152, 191, 221, 341, 348
CviKI_1 RGCY 8 cut(s) 42, 98, 107, 152, 191, 221, 341, 348
CviQI GTAC 1 cut(s) 201
Eco130I CCWWGG 1 cut(s) 209
Eco147I AGGCCT 1 cut(s) 98
Eco32I GATATC 1 cut(s) 255
Eco47III AGCGCT 1 cut(s) 175
EcoRI GAATTC 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 135
EcoRV GATATC 1 cut(s) 255
EcoT14I CCWWGG 1 cut(s) 209
ErhI CCWWGG 1 cut(s) 209
FaeI CATG 1 cut(s) 31
FaiI YATR 4 cut(s) 29, 73, 75, 234
FaqI GGGAC 1 cut(s) 38
FatI CATG 1 cut(s) 27
FauNDI CATATG 1 cut(s) 73
Fnu4HI GCNGC 5 cut(s) 150, 192, 261, 273, 349
Fsp4HI GCNGC 5 cut(s) 150, 192, 261, 273, 349
FspBI CTAG 1 cut(s) 315
FspI TGCGCA 1 cut(s) 327
GlaI GCGC 3 cut(s) 130, 175, 327
GluI GCNGC 5 cut(s) 150, 192, 261, 273, 349
HaeII RGCGCY 2 cut(s) 132, 177
HaeIII GGCC 2 cut(s) 98, 107
HhaI GCGC 3 cut(s) 131, 176, 328
Hin1II CATG 1 cut(s) 31
Hin6I GCGC 3 cut(s) 129, 174, 326
HinP1I GCGC 3 cut(s) 129, 174, 326
HinfI GANTC 4 cut(s) 61, 85, 141, 205
HphI GGTGA 2 cut(s) 46, 277
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 75, 88
HpyCH4V TGCA 4 cut(s) 117, 156, 263, 334
HpyF10VI GCNNNNNNNGC 3 cut(s) 104, 173, 269
Hsp92II CATG 1 cut(s) 31
HspAI GCGC 3 cut(s) 129, 174, 326
LpnPI CCDG 2 cut(s) 122, 149
Lsp1109I GCAGC 4 cut(s) 161, 178, 247, 259
LweI GCATC 1 cut(s) 272
MaeI CTAG 1 cut(s) 315
MboII GAAGA 1 cut(s) 89
MfeI CAATTG 1 cut(s) 267
MluCI AATT 3 cut(s) 6, 229, 267
MnlI CCTC 3 cut(s) 15, 118, 236
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 290
MspCI CTTAAG 1 cut(s) 100
MspR9I CCNGG 1 cut(s) 137
MunI CAATTG 1 cut(s) 267
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 3 cut(s) 104, 173, 269
NdeI CATATG 1 cut(s) 73
NlaIII CATG 1 cut(s) 31
NsbI TGCGCA 1 cut(s) 327
NspI RCATGY 1 cut(s) 31
PceI AGGCCT 1 cut(s) 98
PciI ACATGT 1 cut(s) 27
PfeI GAWTC 4 cut(s) 61, 85, 141, 205
Pfl23II CGTACG 1 cut(s) 200
PkrI GCNGC 5 cut(s) 151, 193, 262, 274, 350
PscI ACATGT 1 cut(s) 27
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspLI CGTACG 1 cut(s) 200
PspPI GGNCC 1 cut(s) 105
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 5 cut(s) 150, 192, 261, 273, 349
Sau96I GGNCC 1 cut(s) 105
ScrFI CCNGG 1 cut(s) 137
SetI ASST 2 cut(s) 154, 228
SfaNI GCATC 1 cut(s) 272
SfiI GGCCNNNNNGGCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 3 cut(s) 100, 240, 343
SmoI CTYRAG 3 cut(s) 100, 240, 343
Sse9I AATT 3 cut(s) 6, 229, 267
SseBI AGGCCT 1 cut(s) 98
SsiI CCGC 2 cut(s) 288, 349
SspMI CTAG 1 cut(s) 315
StuI AGGCCT 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 209
TaqI TCGA 1 cut(s) 46
TasI AATT 3 cut(s) 6, 229, 267
TauI GCSGC 1 cut(s) 351
TfiI GAWTC 4 cut(s) 61, 85, 141, 205
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TscAI CASTG 1 cut(s) 252
TseI GCWGC 4 cut(s) 149, 191, 260, 272
TspDTI ATGAA 2 cut(s) 90, 271
TspRI CASTG 1 cut(s) 252
Vha464I CTTAAG 1 cut(s) 100
XapI RAATTY 1 cut(s) 6
XceI RCATGY 1 cut(s) 31
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.