Rroxscaffold_7G00161510

Early nodulin-93-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0003255
Physical Location & Seq
Forward (+)
4240046 .. 4241710
1665 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00161510.1

Sequence Viewer

Length: 360 bp
ATGGGAATTCCATCGGAAATGAGGGACATGTGGGTGAACAACCGTCGAAACGCTTTGCTGATTCCCTCGCCATATGAAGATGAGATTCAACAGAAGGCCTTAAGGGCCAAAACTTGCACCCAAGAGGGCGCTCGTCAGGGATTCAAGGCAGCTTGCATTTGGGGTGCTGTCAGTGCTGTGCCCACATTGGCTGCTGTTCGTACGATCCCTTGGGCAAAGGCTAACCTCAATTATACTGCTCAAGCGCTGATGATATCTGCTGTATCAATTGCTGCTTACTTCATCACCGCTGATAAAACTATCTTGGAGTGTGCTAGAAAAAATGCGCAGTTGCAACAAGCCTTGAGCCGCCAGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ENOD93

Protein Analysis

119

Amino Acids

13.14

Weight (kDa)

9.6

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ENOD93 PF03386 33 - 108 9.9e-37 Early nodulin 93 ENOD93 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 327
AciI CCGC 2 cut(s) 288, 349
AclWI GGATC 1 cut(s) 199
AcsI RAATTY 1 cut(s) 6
AfaI GTAC 1 cut(s) 202
AfeI AGCGCT 1 cut(s) 246
AflII CTTAAG 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 27
AgsI TTSAA 2 cut(s) 89, 145
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AlwI GGATC 1 cut(s) 199
Aor51HI AGCGCT 1 cut(s) 246
AoxI GGCC 2 cut(s) 96, 105
ApeKI GCWGC 3 cut(s) 149, 191, 272
ApoI RAATTY 1 cut(s) 6
AspLEI GCGC 3 cut(s) 131, 247, 328
AspS9I GGNCC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 46, 277
BaeGI GKGCMC 1 cut(s) 183
BbvI GCAGC 3 cut(s) 161, 178, 259
BccI CCATC 1 cut(s) 19
BfaI CTAG 1 cut(s) 315
BfoI RGCGCY 2 cut(s) 132, 248
BfrI CTTAAG 1 cut(s) 100
BglI GCCNNNNNGGC 1 cut(s) 104
BisI GCNGC 4 cut(s) 150, 192, 273, 349
BlsI GCNGC 4 cut(s) 151, 193, 274, 350
BmgT120I GGNCC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 209
BseSI GKGCMC 1 cut(s) 183
BseXI GCAGC 3 cut(s) 161, 178, 259
BshFI GGCC 2 cut(s) 98, 107
BsiWI CGTACG 1 cut(s) 200
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
BsnI GGCC 2 cut(s) 98, 107
Bsp1286I GDGCHC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 204
BspACI CCGC 2 cut(s) 288, 349
BspANI GGCC 2 cut(s) 98, 107
BspPI GGATC 1 cut(s) 199
BspTI CTTAAG 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 209
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 44
BstAFI CTTAAG 1 cut(s) 100
BstC8I GCNNGC 2 cut(s) 154, 353
BstH2I RGCGCY 2 cut(s) 132, 248
BstHHI GCGC 3 cut(s) 131, 247, 328
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstMWI GCNNNNNNNGC 2 cut(s) 104, 173
BstNSI RCATGY 1 cut(s) 31
BstSLI GKGCMC 1 cut(s) 183
BstV1I GCAGC 3 cut(s) 161, 178, 259
BsuRI GGCC 2 cut(s) 98, 107
BtsIMutI CAGTG 1 cut(s) 178
Cac8I GCNNGC 2 cut(s) 154, 353
CfoI GCGC 3 cut(s) 131, 247, 328
Cfr13I GGNCC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 201
CviAII CATG 1 cut(s) 28
CviJI RGCY 7 cut(s) 98, 107, 152, 191, 221, 341, 348
CviKI_1 RGCY 7 cut(s) 98, 107, 152, 191, 221, 341, 348
CviQI GTAC 1 cut(s) 201
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 209
Eco147I AGGCCT 1 cut(s) 98
Eco32I GATATC 1 cut(s) 255
Eco47III AGCGCT 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 6
EcoRV GATATC 1 cut(s) 255
EcoT14I CCWWGG 1 cut(s) 209
ErhI CCWWGG 1 cut(s) 209
FaeI CATG 1 cut(s) 31
FaiI YATR 4 cut(s) 29, 73, 75, 234
FaqI GGGAC 1 cut(s) 38
FatI CATG 1 cut(s) 27
FauNDI CATATG 1 cut(s) 73
Fnu4HI GCNGC 4 cut(s) 150, 192, 273, 349
Fsp4HI GCNGC 4 cut(s) 150, 192, 273, 349
FspBI CTAG 1 cut(s) 315
FspI TGCGCA 1 cut(s) 327
GlaI GCGC 3 cut(s) 130, 246, 327
GluI GCNGC 4 cut(s) 150, 192, 273, 349
HaeII RGCGCY 2 cut(s) 132, 248
HaeIII GGCC 2 cut(s) 98, 107
HhaI GCGC 3 cut(s) 131, 247, 328
Hin1II CATG 1 cut(s) 31
Hin6I GCGC 3 cut(s) 129, 245, 326
HinP1I GCGC 3 cut(s) 129, 245, 326
HinfI GANTC 3 cut(s) 61, 85, 141
HphI GGTGA 2 cut(s) 46, 277
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 48
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 3 cut(s) 117, 156, 334
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 173
Hsp92II CATG 1 cut(s) 31
HspAI GCGC 3 cut(s) 129, 245, 326
Kzo9I GATC 1 cut(s) 204
LpnPI CCDG 1 cut(s) 122
Lsp1109I GCAGC 3 cut(s) 161, 178, 259
MaeI CTAG 1 cut(s) 315
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 1 cut(s) 89
MfeI CAATTG 1 cut(s) 267
MhlI GDGCHC 1 cut(s) 183
MluCI AATT 3 cut(s) 6, 229, 267
MnlI CCTC 4 cut(s) 15, 76, 118, 236
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 290
MspCI CTTAAG 1 cut(s) 100
MunI CAATTG 1 cut(s) 267
MwoI GCNNNNNNNGC 2 cut(s) 104, 173
NdeI CATATG 1 cut(s) 73
NdeII GATC 1 cut(s) 204
NlaIII CATG 1 cut(s) 31
NsbI TGCGCA 1 cut(s) 327
NspI RCATGY 1 cut(s) 31
PceI AGGCCT 1 cut(s) 98
PciI ACATGT 1 cut(s) 27
PfeI GAWTC 3 cut(s) 61, 85, 141
Pfl23II CGTACG 1 cut(s) 200
PkrI GCNGC 4 cut(s) 151, 193, 274, 350
PscI ACATGT 1 cut(s) 27
PspLI CGTACG 1 cut(s) 200
PspPI GGNCC 1 cut(s) 105
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 4 cut(s) 150, 192, 273, 349
Sau3AI GATC 1 cut(s) 204
Sau96I GGNCC 1 cut(s) 105
SduI GDGCHC 1 cut(s) 183
SetI ASST 2 cut(s) 154, 228
SfiI GGCCNNNNNGGCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 3 cut(s) 100, 240, 343
SmoI CTYRAG 3 cut(s) 100, 240, 343
Sse9I AATT 3 cut(s) 6, 229, 267
SseBI AGGCCT 1 cut(s) 98
SsiI CCGC 2 cut(s) 288, 349
SspMI CTAG 1 cut(s) 315
StuI AGGCCT 1 cut(s) 98
StyI CCWWGG 1 cut(s) 209
TaaI ACNGT 1 cut(s) 44
TaqI TCGA 1 cut(s) 46
TasI AATT 3 cut(s) 6, 229, 267
TauI GCSGC 1 cut(s) 351
TfiI GAWTC 3 cut(s) 61, 85, 141
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TscAI CASTG 1 cut(s) 178
TseI GCWGC 3 cut(s) 149, 191, 272
TspDTI ATGAA 2 cut(s) 90, 271
TspRI CASTG 1 cut(s) 178
Vha464I CTTAAG 1 cut(s) 100
XapI RAATTY 1 cut(s) 6
XceI RCATGY 1 cut(s) 31
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.