MD15G1321400.v1.1

Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0002664
Physical Location & Seq
Reverse (-)
33623651 .. 33624046
396 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1321400.v1.1.491

Sequence Viewer

Length: 396 bp
ATGTTTCGGTTGTACAACCAATCTGGCAGTGGCAGGCCAGACCCTGTATTTGAGCTAAAGTACAGAGACAAGCTAAAAAAGCTTTGCCCTTTAATCATGGGCCAAAATGTGACCGGAGATCTAGATGCTACGCCTTTGGTATTTCACAACCAGTACTACAAGGACTTGGTTTCAGGGAGAAGGTTTATGAATTCTTATCAAACGCTTGTCACATATCCACAGACTAGGATATATGTTGAGCAGTTTAGCAGTGACCAAAGAGATTTTTTCAAGGCCTTTGTTAAAGGGATGATAAAGATAGGAGACTTGCAGTTTGAACAGCCTGGGGAGGTACGAATGAATTGTAGGGTGGTTAATCGTCGTGCTGTCAACACGCATTGGAAGGTGATTACCTAG

Protein Analysis

132

Amino Acids

15.44

Weight (kDa)

9.69

Isoelectric Point (pI)

23.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 3 - 85 9.8e-10 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 190
AfaI GTAC 4 cut(s) 14, 62, 155, 333
AgsI TTSAA 2 cut(s) 271, 317
AjnI CCWGG 1 cut(s) 322
AluBI AGCT 3 cut(s) 55, 73, 82
AluI AGCT 3 cut(s) 55, 73, 82
Alw26I GTCTC 2 cut(s) 60, 297
AlwNI CAGNNNCTG 1 cut(s) 44
AoxI GGCC 3 cut(s) 35, 100, 273
ApoI RAATTY 1 cut(s) 190
ArsI GACNNNNNNTTYG 4 cut(s) 32, 64, 296, 328
AspS9I GGNCC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 324
BcoDI GTCTC 2 cut(s) 60, 297
BfaI CTAG 3 cut(s) 122, 225, 394
BglII AGATCT 1 cut(s) 118
BmcAI AGTACT 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 324
BmgT120I GGNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 324
BmsI GCATC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 323
BsaWI WCCGGW 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 151
BseBI CCWGG 1 cut(s) 324
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 1 cut(s) 294
BseNI ACTGG 1 cut(s) 151
BshFI GGCC 3 cut(s) 37, 102, 275
BsiSI CCGG 1 cut(s) 114
BsmAI GTCTC 2 cut(s) 60, 297
BsnI GGCC 3 cut(s) 37, 102, 275
Bsp1407I TGTACA 1 cut(s) 12
Bsp143I GATC 1 cut(s) 118
BspANI GGCC 3 cut(s) 37, 102, 275
BsrGI TGTACA 1 cut(s) 12
BsrI ACTGG 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 323
BssMI GATC 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 324
BstAUI TGTACA 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 35
BstF5I GGATG 1 cut(s) 294
BstKTI GATC 1 cut(s) 121
BstMAI GTCTC 2 cut(s) 60, 297
BstMBI GATC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 324
BstSCI CCNGG 1 cut(s) 322
BstX2I RGATCY 1 cut(s) 118
BstYI RGATCY 1 cut(s) 118
BsuRI GGCC 3 cut(s) 37, 102, 275
BtsCI GGATG 1 cut(s) 294
BtsI GCAGTG 2 cut(s) 34, 256
BtsIMutI CAGTG 2 cut(s) 34, 256
Cac8I GCNNGC 1 cut(s) 35
CaiI CAGNNNCTG 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 100
Csp6I GTAC 4 cut(s) 13, 61, 154, 332
CviAII CATG 1 cut(s) 97
CviJI RGCY 7 cut(s) 37, 55, 73, 82, 102, 275, 322
CviKI_1 RGCY 7 cut(s) 37, 55, 73, 82, 102, 275, 322
CviQI GTAC 4 cut(s) 13, 61, 154, 332
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
Eco147I AGGCCT 1 cut(s) 275
EcoRI GAATTC 1 cut(s) 190
EcoRII CCWGG 1 cut(s) 322
FaeI CATG 1 cut(s) 100
FaiI YATR 5 cut(s) 98, 188, 214, 232, 234
FatI CATG 1 cut(s) 96
FokI GGATG 1 cut(s) 301
FspBI CTAG 3 cut(s) 122, 225, 394
HaeIII GGCC 3 cut(s) 37, 102, 275
HapII CCGG 1 cut(s) 114
Hin1II CATG 1 cut(s) 100
HincII GTYRAC 1 cut(s) 370
HindII GTYRAC 1 cut(s) 370
HindIII AAGCTT 1 cut(s) 80
HpaII CCGG 1 cut(s) 114
Hpy166II GTNNAC 1 cut(s) 370
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 1 cut(s) 370
Hpy99I CGWCG 1 cut(s) 363
HpyAV CCTTC 2 cut(s) 174, 376
HpyCH4V TGCA 1 cut(s) 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 9 cut(s) 9, 19, 51, 57, 127, 159, 164, 309, 336
LweI GCATC 1 cut(s) 115
MaeI CTAG 3 cut(s) 122, 225, 394
MaeIII GTNAC 3 cut(s) 109, 208, 251
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MflI RGATCY 1 cut(s) 118
MluCI AATT 2 cut(s) 190, 340
MnlI CCTC 1 cut(s) 322
MseI TTAA 3 cut(s) 92, 282, 354
MspI CCGG 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 324
MvaI CCWGG 1 cut(s) 324
MwoI GCNNNNNNNGC 1 cut(s) 79
NdeII GATC 1 cut(s) 118
NlaIII CATG 1 cut(s) 100
NmuCI GTSAC 3 cut(s) 109, 208, 251
PceI AGGCCT 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 322
PspGI CCWGG 1 cut(s) 322
PspPI GGNCC 1 cut(s) 100
PstNI CAGNNNCTG 1 cut(s) 44
PsuI RGATCY 1 cut(s) 118
RsaI GTAC 4 cut(s) 14, 62, 155, 333
RsaNI GTAC 4 cut(s) 13, 61, 154, 332
SaqAI TTAA 3 cut(s) 92, 282, 354
Sau3AI GATC 1 cut(s) 118
Sau96I GGNCC 1 cut(s) 100
ScaI AGTACT 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 324
SetI ASST 7 cut(s) 57, 75, 84, 185, 333, 387, 395
SfaNI GCATC 1 cut(s) 115
Sse9I AATT 2 cut(s) 190, 340
SseBI AGGCCT 1 cut(s) 275
SspMI CTAG 3 cut(s) 122, 225, 394
StuI AGGCCT 1 cut(s) 275
StyD4I CCNGG 1 cut(s) 322
TasI AATT 2 cut(s) 190, 340
TatI WGTACW 3 cut(s) 12, 60, 153
Tru1I TTAA 3 cut(s) 92, 282, 354
Tru9I TTAA 3 cut(s) 92, 282, 354
TscAI CASTG 2 cut(s) 34, 256
TseFI GTSAC 3 cut(s) 109, 208, 251
Tsp45I GTSAC 3 cut(s) 109, 208, 251
TspDTI ATGAA 2 cut(s) 203, 353
TspRI CASTG 2 cut(s) 34, 256
XapI RAATTY 1 cut(s) 190
XbaI TCTAGA 1 cut(s) 121
XcmI CCANNNNNNNNNTGG 1 cut(s) 26
XspI CTAG 3 cut(s) 122, 225, 394
ZrmI AGTACT 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.