Rmu_co8310909.1_g000001

Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8310909.1
Physical Location & Seq
Reverse (-)
178 .. 684
507 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8310909.1_g000001.1.cds

Sequence Viewer

Length: 507 bp
atgccgagtccaagagccgatgcaacctccctcattgacctctttgccaaattcaatctttctgtcaaagaccttgttgcgctttcagggtcacactccattggacaggggcggtgcttttccatcatgtttcggctgtacaaccaatccggcactggcaggccagaccctgccattgaaccaaagtttagagaaaagctaaagaaactatgccctttgaatgtggaccaaaatgtgactggagaccttgatgctacacctataatatttgataaccagtacttcaaggacttggcttccgggagagggtttctgaattcggatcaaacacttttcacatttccgcagacaagaggatttgttaagctgttcagcaatgatcaaggagaatttttcaaggcttttattgaggggatgataaagatgggtgacttgcagattgagcaacctggggagataaggaaaaattgcagggtggctaatcgtcgccctatcaacacattctga

Protein Analysis

168

Amino Acids

18.9

Weight (kDa)

9.07

Isoelectric Point (pI)

34.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 112, 344
AclWI GGATC 1 cut(s) 330
AcsI RAATTY 3 cut(s) 50, 316, 389
AfaI GTAC 2 cut(s) 140, 281
AfiI CCNNNNNNNGG 1 cut(s) 306
AgsI TTSAA 5 cut(s) 55, 179, 220, 286, 397
AjnI CCWGG 1 cut(s) 448
AluBI AGCT 2 cut(s) 199, 367
AluI AGCT 2 cut(s) 199, 367
Alw26I GTCTC 1 cut(s) 237
AlwI GGATC 1 cut(s) 330
AlwNI CAGNNNCTG 1 cut(s) 170
AoxI GGCC 1 cut(s) 161
ApoI RAATTY 3 cut(s) 50, 316, 389
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 226
AsuC2I CCSGG 1 cut(s) 301
AsuHPI GGTGA 1 cut(s) 440
AvaII GGWCC 1 cut(s) 226
BccI CCATC 2 cut(s) 131, 418
BciT130I CCWGG 1 cut(s) 450
BclI TGATCA 1 cut(s) 379
BcnI CCSGG 1 cut(s) 301
BcoDI GTCTC 1 cut(s) 237
BmcAI AGTACT 1 cut(s) 281
Bme1390I CCNGG 2 cut(s) 301, 450
Bme18I GGWCC 1 cut(s) 226
BmgT120I GGNCC 1 cut(s) 226
BmrFI CCNGG 2 cut(s) 301, 450
BmsI GCATC 2 cut(s) 10, 241
BpmI CTGGAG 1 cut(s) 261
BpuMI CCSGG 1 cut(s) 301
BsaI GGTCTC 1 cut(s) 237
BsaJI CCNNGG 1 cut(s) 449
Bsc4I CCNNNNNNNGG 1 cut(s) 306
Bse1I ACTGG 3 cut(s) 160, 244, 277
Bse3DI GCAATG 1 cut(s) 382
BseBI CCWGG 1 cut(s) 450
BseDI CCNNGG 1 cut(s) 449
BseGI GGATG 1 cut(s) 420
BseLI CCNNNNNNNGG 1 cut(s) 306
BseMI GCAATG 1 cut(s) 382
BseNI ACTGG 3 cut(s) 160, 244, 277
BshFI GGCC 1 cut(s) 163
BsiSI CCGG 2 cut(s) 150, 300
BslI CCNNNNNNNGG 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 237
BsnI GGCC 1 cut(s) 163
Bso31I GGTCTC 1 cut(s) 237
Bsp1407I TGTACA 1 cut(s) 138
Bsp143I GATC 2 cut(s) 322, 379
BspACI CCGC 2 cut(s) 112, 344
BspANI GGCC 1 cut(s) 163
BspPI GGATC 1 cut(s) 330
BspTNI GGTCTC 1 cut(s) 237
BsrDI GCAATG 1 cut(s) 382
BsrGI TGTACA 1 cut(s) 138
BsrI ACTGG 3 cut(s) 160, 244, 277
BssECI CCNNGG 1 cut(s) 449
BssMI GATC 2 cut(s) 322, 379
Bst2UI CCWGG 1 cut(s) 450
BstAUI TGTACA 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 161
BstF5I GGATG 1 cut(s) 420
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 2 cut(s) 325, 382
BstMAI GTCTC 1 cut(s) 237
BstMBI GATC 2 cut(s) 322, 379
BstMWI GCNNNNNNNGC 1 cut(s) 442
BstNI CCWGG 1 cut(s) 450
BstSCI CCNGG 2 cut(s) 299, 448
BsuRI GGCC 1 cut(s) 163
BtsCI GGATG 1 cut(s) 420
BtsIMutI CAGTG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 161
CaiI CAGNNNCTG 1 cut(s) 170
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 226
Csp6I GTAC 2 cut(s) 139, 280
CviAII CATG 1 cut(s) 127
CviJI RGCY 8 cut(s) 17, 136, 163, 199, 296, 367, 401, 479
CviKI_1 RGCY 8 cut(s) 17, 136, 163, 199, 296, 367, 401, 479
CviQI GTAC 2 cut(s) 139, 280
DpnI GATC 2 cut(s) 324, 381
DpnII GATC 2 cut(s) 322, 379
Eco31I GGTCTC 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 226
EcoRI GAATTC 1 cut(s) 316
EcoRII CCWGG 1 cut(s) 448
FaeI CATG 1 cut(s) 130
FaiI YATR 3 cut(s) 128, 211, 263
FatI CATG 1 cut(s) 126
FbaI TGATCA 1 cut(s) 379
FokI GGATG 1 cut(s) 427
GlaI GCGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 261
HaeIII GGCC 1 cut(s) 163
HapII CCGG 2 cut(s) 150, 300
HhaI GCGC 1 cut(s) 82
Hin1II CATG 1 cut(s) 130
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HinfI GANTC 1 cut(s) 7
HpaII CCGG 2 cut(s) 150, 300
HphI GGTGA 1 cut(s) 440
Hpy166II GTNNAC 1 cut(s) 226
Hpy188I TCNGA 3 cut(s) 315, 322, 506
Hpy8I GTNNAC 1 cut(s) 226
Hpy99I CGWCG 1 cut(s) 489
HpyCH4V TGCA 3 cut(s) 23, 436, 471
HpyF10VI GCNNNNNNNGC 1 cut(s) 442
Hsp92II CATG 1 cut(s) 130
HspAI GCGC 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 379
Kzo9I GATC 2 cut(s) 322, 379
LweI GCATC 2 cut(s) 10, 241
MaeIII GTNAC 3 cut(s) 90, 235, 428
MalI GATC 2 cut(s) 324, 381
MboI GATC 2 cut(s) 322, 379
MluCI AATT 4 cut(s) 50, 316, 389, 466
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 6 cut(s) 37, 41, 50, 299, 347, 403
MseI TTAA 1 cut(s) 363
MspI CCGG 2 cut(s) 150, 300
MspR9I CCNGG 2 cut(s) 301, 450
MvaI CCWGG 1 cut(s) 450
MwoI GCNNNNNNNGC 1 cut(s) 442
NciI CCSGG 1 cut(s) 301
NdeII GATC 2 cut(s) 322, 379
NlaIII CATG 1 cut(s) 130
NmeAIII GCCGAG 1 cut(s) 30
NmuCI GTSAC 3 cut(s) 90, 235, 428
PfoI TCCNGGA 1 cut(s) 299
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 448
PspGI CCWGG 1 cut(s) 448
PspPI GGNCC 1 cut(s) 226
PstNI CAGNNNCTG 1 cut(s) 170
RsaI GTAC 2 cut(s) 140, 281
RsaNI GTAC 2 cut(s) 139, 280
SaqAI TTAA 1 cut(s) 363
Sau3AI GATC 2 cut(s) 322, 379
Sau96I GGNCC 1 cut(s) 226
ScaI AGTACT 1 cut(s) 281
SchI GAGTC 1 cut(s) 16
ScrFI CCNGG 2 cut(s) 301, 450
SetI ASST 8 cut(s) 29, 42, 75, 201, 249, 262, 369, 451
SfaNI GCATC 2 cut(s) 10, 241
SinI GGWCC 1 cut(s) 226
Sse9I AATT 4 cut(s) 50, 316, 389, 466
SsiI CCGC 2 cut(s) 112, 344
SspI AATATT 1 cut(s) 267
StyD4I CCNGG 2 cut(s) 299, 448
TasI AATT 4 cut(s) 50, 316, 389, 466
TatI WGTACW 2 cut(s) 138, 279
Tru1I TTAA 1 cut(s) 363
Tru9I TTAA 1 cut(s) 363
TscAI CASTG 1 cut(s) 160
TseFI GTSAC 3 cut(s) 90, 235, 428
Tsp45I GTSAC 3 cut(s) 90, 235, 428
TspRI CASTG 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 226
XapI RAATTY 3 cut(s) 50, 316, 389
XcmI CCANNNNNNNNNTGG 2 cut(s) 152, 236
ZrmI AGTACT 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.