MD15G1364000.v1.1

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
44126184 .. 44126387
204 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1364000.v1.1.491

Sequence Viewer

Length: 204 bp
ATGGGATCATTTTTCTATCATATAGGAAGGGCTATTGCACAAAATGTACTTATAAGTAATTGCTCCATAGATCCTATATCTATCTATATGAAGAAGAAATCGTGTAACGAAGGGGATTATTATTTGTACAAATGGTACTTTGAACTTGGAATGAGTATGAAGAAATTAACGATACTTCTTTATCTTTTGAGTTGTTCTACCTGA

Protein Analysis

68

Amino Acids

7.81

Weight (kDa)

8.82

Isoelectric Point (pI)

48.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 53
AclWI GGATC 2 cut(s) 13, 65
AfaI GTAC 3 cut(s) 48, 128, 137
AgsI TTSAA 1 cut(s) 143
AlwI GGATC 2 cut(s) 13, 65
Bsp1407I TGTACA 1 cut(s) 126
Bsp143I GATC 2 cut(s) 5, 70
BspPI GGATC 2 cut(s) 13, 65
BsrGI TGTACA 1 cut(s) 126
BssMI GATC 2 cut(s) 5, 70
BstAUI TGTACA 1 cut(s) 126
BstKTI GATC 2 cut(s) 8, 73
BstMBI GATC 2 cut(s) 5, 70
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
Csp6I GTAC 3 cut(s) 47, 127, 136
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
CviQI GTAC 3 cut(s) 47, 127, 136
DpnI GATC 2 cut(s) 7, 72
DpnII GATC 2 cut(s) 5, 70
FaiI YATR 8 cut(s) 21, 23, 53, 68, 77, 87, 89, 158
HpyAV CCTTC 2 cut(s) 21, 104
HpyCH4V TGCA 1 cut(s) 38
Kzo9I GATC 2 cut(s) 5, 70
LmnI GCTCC 1 cut(s) 68
MaeIII GTNAC 1 cut(s) 104
MalI GATC 2 cut(s) 7, 72
MboI GATC 2 cut(s) 5, 70
MboII GAAGA 3 cut(s) 103, 106, 172
MflI RGATCY 1 cut(s) 70
MluCI AATT 2 cut(s) 58, 164
MseI TTAA 1 cut(s) 167
NdeII GATC 2 cut(s) 5, 70
PsiI TTATAA 1 cut(s) 53
PsuI RGATCY 1 cut(s) 70
RsaI GTAC 3 cut(s) 48, 128, 137
RsaNI GTAC 3 cut(s) 47, 127, 136
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 2 cut(s) 5, 70
SetI ASST 1 cut(s) 203
SgeI CNNG 2 cut(s) 114, 158
Sse9I AATT 2 cut(s) 58, 164
TasI AATT 2 cut(s) 58, 164
TatI WGTACW 2 cut(s) 46, 126
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TspDTI ATGAA 2 cut(s) 104, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.