RchiOBHm_Chr2g0118461

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001704
Physical Location & Seq
Reverse (-)
30721301 .. 30721747
447 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49126

Sequence Viewer

Length: 447 bp
ATGTTTGCTTTTCGTGAAAAAATACCAATTGAAGCGGAGGTTTTCTTCAAACAACAAGGAGCTGGGTCAACTATTCAATTAAATGAAATTGAGCATGTTTCCCATATCTTCTCGAGAAACAAGTGGGCTATGCAAAATTGTGCTCAATTTCATATGTGGCAATTCCGCCAAGATCTCTTCTTTAGTTGGGGGAAGAATCTGCACGAATCAGATTTTTTGAGGAACATATCGAGAGAGAATTGGTTAGACAATGTGTGGTTGGTAAACAAGGATCGGTTTTTTAGCAAGGTACGGAATGTATCGTCAAATATTCAATATGATTCCACAAGATCTAGTTTTGTTCAAGTAACAGATTCTAGCCAATTGAAAGGATCCTCTGATCAATCCAGAGATCGTTTCGATTCCATTAGTAATGAGGATTCAGAATATCACACATTGATCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF825

Protein Analysis

148

Amino Acids

17.61

Weight (kDa)

6.19

Isoelectric Point (pI)

56.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 148 5.5e-85 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 35, 166
AclWI GGATC 3 cut(s) 279, 366, 379
AfaI GTAC 1 cut(s) 291
AgsI TTSAA 6 cut(s) 32, 49, 77, 314, 344, 367
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
Alw21I GWGCWC 1 cut(s) 145
AlwI GGATC 3 cut(s) 279, 366, 379
Ama87I CYCGRG 1 cut(s) 112
AvaI CYCGRG 1 cut(s) 112
BamHI GGATCC 1 cut(s) 371
Bbv12I GWGCWC 1 cut(s) 145
BclI TGATCA 2 cut(s) 379, 438
BfaI CTAG 2 cut(s) 333, 357
BglII AGATCT 2 cut(s) 172, 329
BmeT110I CYCGRG 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 373
BseYI CCCAGC 1 cut(s) 62
BsgI GTGCAG 1 cut(s) 185
BsiHKAI GWGCWC 1 cut(s) 145
BsiHKCI CYCGRG 1 cut(s) 112
BsoBI CYCGRG 1 cut(s) 112
Bsp1286I GDGCHC 1 cut(s) 145
Bsp143I GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
BspACI CCGC 2 cut(s) 35, 166
BspLI GGNNCC 1 cut(s) 373
BspPI GGATC 3 cut(s) 279, 366, 379
BssMI GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
Bst6I CTCTTC 1 cut(s) 182
BstKTI GATC 7 cut(s) 175, 274, 332, 374, 382, 394, 441
BstMBI GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
BstNSI RCATGY 1 cut(s) 98
BstX2I RGATCY 3 cut(s) 172, 329, 371
BstYI RGATCY 3 cut(s) 172, 329, 371
Csp6I GTAC 1 cut(s) 290
CviAII CATG 1 cut(s) 95
CviJI RGCY 3 cut(s) 62, 128, 360
CviKI_1 RGCY 3 cut(s) 62, 128, 360
CviQI GTAC 1 cut(s) 290
DpnI GATC 7 cut(s) 174, 273, 331, 373, 381, 393, 440
DpnII GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
Eam1104I CTCTTC 1 cut(s) 182
EarI CTCTTC 1 cut(s) 182
EciI GGCGGA 1 cut(s) 155
Eco88I CYCGRG 1 cut(s) 112
FaeI CATG 1 cut(s) 98
FaiI YATR 7 cut(s) 96, 105, 131, 153, 155, 227, 318
FatI CATG 1 cut(s) 94
FauNDI CATATG 1 cut(s) 153
FbaI TGATCA 2 cut(s) 379, 438
FspBI CTAG 2 cut(s) 333, 357
GsaI CCCAGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 98
HincII GTYRAC 1 cut(s) 69
HindII GTYRAC 1 cut(s) 69
HinfI GANTC 6 cut(s) 196, 206, 320, 353, 401, 419
Hpy166II GTNNAC 2 cut(s) 69, 265
Hpy188I TCNGA 3 cut(s) 211, 379, 424
Hpy188III TCNNGA 5 cut(s) 14, 112, 114, 231, 387
Hpy8I GTNNAC 2 cut(s) 69, 265
HpyCH4V TGCA 2 cut(s) 133, 202
Hsp92II CATG 1 cut(s) 98
Ksp22I TGATCA 2 cut(s) 379, 438
Kzo9I GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 2 cut(s) 48, 400
MaeI CTAG 2 cut(s) 333, 357
MaeIII GTNAC 1 cut(s) 346
MalI GATC 7 cut(s) 174, 273, 331, 373, 381, 393, 440
MboI GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
MboII GAAGA 4 cut(s) 37, 100, 169, 205
MfeI CAATTG 2 cut(s) 27, 362
MflI RGATCY 3 cut(s) 172, 329, 371
MhlI GDGCHC 1 cut(s) 145
MluCI AATT 9 cut(s) 27, 77, 87, 136, 146, 161, 238, 362, 442
MnlI CCTC 4 cut(s) 31, 213, 385, 409
MseI TTAA 2 cut(s) 80, 445
MunI CAATTG 2 cut(s) 27, 362
NdeI CATATG 1 cut(s) 153
NdeII GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
NlaIII CATG 1 cut(s) 98
NlaIV GGNNCC 1 cut(s) 373
NspI RCATGY 1 cut(s) 98
PaeR7I CTCGAG 1 cut(s) 112
PfeI GAWTC 6 cut(s) 196, 206, 320, 353, 401, 419
PspFI CCCAGC 1 cut(s) 62
PspN4I GGNNCC 1 cut(s) 373
PsuI RGATCY 3 cut(s) 172, 329, 371
RsaI GTAC 1 cut(s) 291
RsaNI GTAC 1 cut(s) 290
SaqAI TTAA 2 cut(s) 80, 445
Sau3AI GATC 7 cut(s) 172, 271, 329, 371, 379, 391, 438
SduI GDGCHC 1 cut(s) 145
SetI ASST 3 cut(s) 42, 64, 291
Sfr274I CTCGAG 1 cut(s) 112
SlaI CTCGAG 1 cut(s) 112
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 9 cut(s) 27, 77, 87, 136, 146, 161, 238, 362, 442
SsiI CCGC 2 cut(s) 35, 166
SspI AATATT 1 cut(s) 310
SspMI CTAG 2 cut(s) 333, 357
TaqI TCGA 3 cut(s) 113, 230, 399
TasI AATT 9 cut(s) 27, 77, 87, 136, 146, 161, 238, 362, 442
TfiI GAWTC 6 cut(s) 196, 206, 320, 353, 401, 419
Tru1I TTAA 2 cut(s) 80, 445
Tru9I TTAA 2 cut(s) 80, 445
TspDTI ATGAA 2 cut(s) 99, 140
TspGWI ACGGA 1 cut(s) 307
XceI RCATGY 1 cut(s) 98
XhoI CTCGAG 1 cut(s) 112
XspI CTAG 2 cut(s) 333, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.