MD15G1364100.v1.1

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
44126878 .. 44127315
438 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1364100.v1.1.491

Sequence Viewer

Length: 438 bp
ATGAATTATGAGTTCAATACATCATGTTTAGCAGAAAGACGGATATTCCTTGCTCATTACCAGACAATTACTTATTCACAAACCTCCTGTGGGGCTAATAGTTTTCATTTCACATATCATGGAAAACCCTATTCGCTCTGCTTAGCCCTTTTTAGGGGTATTTTAGTGATAGGTTCTATAGGAACTAGACGATCCTATTTGGCTAAATACCTAGCGACAAACTCTTATATTCCTTTCATTACAGTATTTCTGAACAAGTTCTTGGCTAACAAACCCAAGAGTTTTCTTGTTGATGATAATGACGATATTGATGATAGTGATGACCGTGACTTTGATACAAAGTTAGCGCTTATTGATGATAGTGACGACCGTGACTTTGATATAGAGTTAACGCTTCTAACTATGGATATGATGCCGGAAATAAACTCTTCAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.64

Weight (kDa)

4.64

Isoelectric Point (pI)

40.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 186
AfeI AGCGCT 1 cut(s) 348
AfiI CCNNNNNNNGG 3 cut(s) 90, 153, 154
AgsI TTSAA 2 cut(s) 16, 432
AjuI GAANNNNNNNTTGG 2 cut(s) 245, 277
AlwI GGATC 1 cut(s) 186
Aor51HI AGCGCT 1 cut(s) 348
ArsI GACNNNNNNTTYG 4 cut(s) 314, 346, 359, 391
Asp700I GAANNNNTTC 1 cut(s) 257
AspLEI GCGC 1 cut(s) 349
BfaI CTAG 2 cut(s) 186, 212
BfmI CTRYAG 1 cut(s) 177
BfoI RGCGCY 1 cut(s) 350
BlpI GCTNAGC 1 cut(s) 142
BmsI GCATC 1 cut(s) 402
Bpu1102I GCTNAGC 1 cut(s) 142
Bsc4I CCNNNNNNNGG 3 cut(s) 90, 153, 154
BseLI CCNNNNNNNGG 3 cut(s) 90, 153, 154
Bsh1285I CGRYCG 1 cut(s) 370
BsiEI CGRYCG 1 cut(s) 370
BsiSI CCGG 1 cut(s) 416
BslI CCNNNNNNNGG 3 cut(s) 90, 153, 154
Bsp143I GATC 1 cut(s) 191
Bsp1720I GCTNAGC 1 cut(s) 142
BspPI GGATC 1 cut(s) 186
BssMI GATC 1 cut(s) 191
Bst4CI ACNGT 3 cut(s) 244, 326, 371
Bst6I CTCTTC 1 cut(s) 433
BstDEI CTNAG 1 cut(s) 142
BstH2I RGCGCY 1 cut(s) 350
BstHHI GCGC 1 cut(s) 349
BstKTI GATC 1 cut(s) 194
BstMBI GATC 1 cut(s) 191
BstMCI CGRYCG 1 cut(s) 370
BstSFI CTRYAG 1 cut(s) 177
CfoI GCGC 1 cut(s) 349
CviAII CATG 2 cut(s) 24, 119
CviJI RGCY 4 cut(s) 95, 146, 203, 266
CviKI_1 RGCY 4 cut(s) 95, 146, 203, 266
DdeI CTNAG 1 cut(s) 142
DpnI GATC 1 cut(s) 193
DpnII GATC 1 cut(s) 191
Eam1104I CTCTTC 1 cut(s) 433
EarI CTCTTC 1 cut(s) 433
Eco47III AGCGCT 1 cut(s) 348
FaeI CATG 2 cut(s) 27, 122
FaiI YATR 9 cut(s) 9, 25, 115, 120, 179, 228, 383, 404, 410
FatI CATG 2 cut(s) 23, 118
FspBI CTAG 2 cut(s) 186, 212
GlaI GCGC 1 cut(s) 348
HaeII RGCGCY 1 cut(s) 350
HapII CCGG 1 cut(s) 416
HhaI GCGC 1 cut(s) 349
Hin1II CATG 2 cut(s) 27, 122
Hin6I GCGC 1 cut(s) 347
HinP1I GCGC 1 cut(s) 347
HincII GTYRAC 1 cut(s) 390
HindII GTYRAC 1 cut(s) 390
HpaI GTTAAC 1 cut(s) 390
HpaII CCGG 1 cut(s) 416
Hpy166II GTNNAC 1 cut(s) 390
Hpy188I TCNGA 1 cut(s) 252
Hpy8I GTNNAC 1 cut(s) 390
HpyCH4III ACNGT 3 cut(s) 244, 326, 371
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 2 cut(s) 27, 122
HspAI GCGC 1 cut(s) 347
KspAI GTTAAC 1 cut(s) 390
Kzo9I GATC 1 cut(s) 191
LpnPI CCDG 3 cut(s) 74, 100, 429
LweI GCATC 1 cut(s) 402
MaeI CTAG 2 cut(s) 186, 212
MaeIII GTNAC 3 cut(s) 326, 362, 371
MalI GATC 1 cut(s) 193
MboI GATC 1 cut(s) 191
MboII GAAGA 1 cut(s) 420
MluCI AATT 3 cut(s) 4, 66, 432
MnlI CCTC 1 cut(s) 94
MroXI GAANNNNTTC 1 cut(s) 257
MseI TTAA 1 cut(s) 389
MspI CCGG 1 cut(s) 416
NdeII GATC 1 cut(s) 191
NlaIII CATG 2 cut(s) 27, 122
NmuCI GTSAC 3 cut(s) 326, 362, 371
PdmI GAANNNNTTC 1 cut(s) 257
SaqAI TTAA 1 cut(s) 389
Sau3AI GATC 1 cut(s) 191
SetI ASST 3 cut(s) 86, 175, 213
SfaNI GCATC 1 cut(s) 402
SfcI CTRYAG 1 cut(s) 177
Sse9I AATT 3 cut(s) 4, 66, 432
SspMI CTAG 2 cut(s) 186, 212
TaaI ACNGT 3 cut(s) 244, 326, 371
TasI AATT 3 cut(s) 4, 66, 432
Tru1I TTAA 1 cut(s) 389
Tru9I TTAA 1 cut(s) 389
TseFI GTSAC 3 cut(s) 326, 362, 371
Tsp45I GTSAC 3 cut(s) 326, 362, 371
TspDTI ATGAA 3 cut(s) 17, 95, 226
TspGWI ACGGA 1 cut(s) 55
XmnI GAANNNNTTC 1 cut(s) 257
XspI CTAG 2 cut(s) 186, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.