Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00001682

Orthogroup ID

OG0001704

Physical Location & Seq

Genomic Coordinates Reverse (-)

12743 .. 13334

Gene Structure 592 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom1682g00010.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 501 bp

ATGGCGCCTTGGGGCTTTCTATTTGATTGTATCGAAAGGCCCAATGAATTGGGATTTCCCTATTGGGTCAGGTCATTTCGGGGCAAGCGGATCATTTATGATGAAGAGGATGGGCTTCAAGAGAATGATTCGGAGTTCTTGCAGAGTGGAACCATGCACCAATTCATTTGGGACCCTGCGGATCCACTCTTTTTCCTATTCAAAGATCAGCCTGTGTTTTCACATCGAGAATTCTTTGCAGATGAAGAGATGTCAAAGGGGCTTCTTACTTCCCAAACGGATCTTCCTACATCTATATATAAACGCTGGTTTATCAAGAATACGCAAGAAAGGTACTTCGAATTGTTAATTCATCGCCAGAGATGGCTTAGAACCAATAGTTCATTATCTAATGGATTTTTCCTGTTCCTATCTAACGGAACGCTATTGGATCAAATGACAAAGACATTGTTGAGAAAAAGATGGCTTTTCCCGGATGAAATGAAAATTGGATTCATGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF825

Protein Analysis

167

Amino Acids

20.05

Weight (kDa)

5.65

Isoelectric Point (pI)

61.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001704)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00860 ATCG01280
fragaria_vesca	FvH4_c3g00160
malus_domestica	MD15G1364000.v1.1 MD15G1364100.v1.1 MD15G1364300.v1.1
pyrus_communis	pycom11g21060 pycom12397g00050 pycom12397g00150 pycom13g12670 pycom13g17800 pycom1682g00010 pycom3137g00010 pycom3137g00020
rosa_chinensis	RchiOBHm_Chr2g0118461 RchiOBHm_Chr2g0118471
rosa_laevigata	RLG00000000001 RLG00000000007 RLG00000000030 RLG00000000031 RLG00000000036 RLG00000000037 RLG00000000059 RLG00000000060 RLG00000000094 RLG00000000095 RLG00000000101 RLG00000000102 RLG00000000181 RLG00000000182 RLG00000000214 RLG00000000215 RLG00000000239 RLG00000000254 RLG00000000255 RLG00000000301 RLG00000000305 RLG00000000306 RLG00000016742 RLG00000029142 RLG00000037092 RLG00000037093 RLG00000037098 RLG00000037099 RLG00000037112
rosa_rugosa	RorugMtG0003000.1 RorugMtG0003400.1
rosa_samantha	Rh1BG209600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	4
AciI	CCGC	2 cut(s)	88, 179
AclWI	GGATC	5 cut(s)	98, 176, 189, 288, 438
AcsI	RAATTY	1 cut(s)	230
AcyI	GRCGYC	1 cut(s)	5
AfaI	GTAC	1 cut(s)	335
AgsI	TTSAA	2 cut(s)	119, 202
AjuI	GAANNNNNNNTTGG	3 cut(s)	267, 299, 471
AlwI	GGATC	5 cut(s)	98, 176, 189, 288, 438
AoxI	GGCC	1 cut(s)	38
ApoI	RAATTY	1 cut(s)	230
AspLEI	GCGC	1 cut(s)	7
AspS9I	GGNCC	2 cut(s)	39, 172
AsuC2I	CCSGG	1 cut(s)	473
AsuII	TTCGAA	1 cut(s)	339
AvaII	GGWCC	1 cut(s)	172
BamHI	GGATCC	1 cut(s)	181
BanI	GGYRCC	1 cut(s)	4
BccI	CCATC	3 cut(s)	104, 357, 456
BcnI	CCSGG	1 cut(s)	473
BfoI	RGCGCY	1 cut(s)	8
Bme1390I	CCNGG	1 cut(s)	473
Bme18I	GGWCC	1 cut(s)	172
BmgT120I	GGNCC	2 cut(s)	39, 172
BmiI	GGNNCC	5 cut(s)	6, 151, 173, 174, 183
BmrFI	CCNGG	1 cut(s)	473
Bpu14I	TTCGAA	1 cut(s)	339
BpuMI	CCSGG	1 cut(s)	473
BsaHI	GRCGYC	1 cut(s)	5
BsaJI	CCNNGG	1 cut(s)	8
BseDI	CCNNGG	1 cut(s)	8
BseGI	GGATG	2 cut(s)	115, 481
BshFI	GGCC	1 cut(s)	40
BshNI	GGYRCC	1 cut(s)	4
BsiSI	CCGG	1 cut(s)	473
BslFI	GGGAC	1 cut(s)	185
BsmFI	GGGAC	1 cut(s)	185
BsnI	GGCC	1 cut(s)	40
Bsp119I	TTCGAA	1 cut(s)	339
Bsp143I	GATC	5 cut(s)	90, 181, 205, 280, 430
BspACI	CCGC	2 cut(s)	88, 179
BspANI	GGCC	1 cut(s)	40
BspLI	GGNNCC	5 cut(s)	6, 151, 173, 174, 183
BspPI	GGATC	5 cut(s)	98, 176, 189, 288, 438
BspT104I	TTCGAA	1 cut(s)	339
BspT107I	GGYRCC	1 cut(s)	4
BssECI	CCNNGG	1 cut(s)	8
BssMI	GATC	5 cut(s)	90, 181, 205, 280, 430
BssNI	GRCGYC	1 cut(s)	5
BssT1I	CCWWGG	1 cut(s)	8
Bst6I	CTCTTC	2 cut(s)	99, 240
BstACI	GRCGYC	1 cut(s)	5
BstBI	TTCGAA	1 cut(s)	339
BstC8I	GCNNGC	1 cut(s)	86
BstDEI	CTNAG	1 cut(s)	368
BstF5I	GGATG	2 cut(s)	115, 481
BstH2I	RGCGCY	1 cut(s)	8
BstHHI	GCGC	1 cut(s)	7
BstKTI	GATC	5 cut(s)	93, 184, 208, 283, 433
BstMBI	GATC	5 cut(s)	90, 181, 205, 280, 430
BstSCI	CCNGG	1 cut(s)	471
BstX2I	RGATCY	2 cut(s)	181, 280
BstXI	CCANNNNNNTGG	1 cut(s)	49
BstYI	RGATCY	2 cut(s)	181, 280
BsuRI	GGCC	1 cut(s)	40
BtgZI	GCGATG	1 cut(s)	338
BtsCI	GGATG	2 cut(s)	115, 481
Cac8I	GCNNGC	1 cut(s)	86
CfoI	GCGC	1 cut(s)	7
Cfr13I	GGNCC	2 cut(s)	39, 172
Csp6I	GTAC	1 cut(s)	334
CviAII	CATG	2 cut(s)	154, 496
CviJI	RGCY	7 cut(s)	15, 40, 115, 211, 262, 367, 466
CviKI_1	RGCY	7 cut(s)	15, 40, 115, 211, 262, 367, 466
CviQI	GTAC	1 cut(s)	334
DdeI	CTNAG	1 cut(s)	368
DinI	GGCGCC	1 cut(s)	6
DpnI	GATC	5 cut(s)	92, 183, 207, 282, 432
DpnII	GATC	5 cut(s)	90, 181, 205, 280, 430
Eam1104I	CTCTTC	2 cut(s)	99, 240
EarI	CTCTTC	2 cut(s)	99, 240
Eco130I	CCWWGG	1 cut(s)	8
Eco47I	GGWCC	1 cut(s)	172
EcoO109I	RGGNCCY	1 cut(s)	172
EcoRI	GAATTC	1 cut(s)	230
EcoT14I	CCWWGG	1 cut(s)	8
EgeI	GGCGCC	1 cut(s)	6
EheI	GGCGCC	1 cut(s)	6
ErhI	CCWWGG	1 cut(s)	8
FaeI	CATG	2 cut(s)	157, 499
FaiI	YATR	6 cut(s)	99, 155, 296, 298, 300, 497
FaqI	GGGAC	1 cut(s)	185
FatI	CATG	2 cut(s)	153, 495
FokI	GGATG	2 cut(s)	122, 488
GlaI	GCGC	1 cut(s)	6
HaeII	RGCGCY	1 cut(s)	8
HaeIII	GGCC	1 cut(s)	40
HapII	CCGG	1 cut(s)	473
HhaI	GCGC	1 cut(s)	7
Hin1I	GRCGYC	1 cut(s)	5
Hin1II	CATG	2 cut(s)	157, 499
Hin6I	GCGC	1 cut(s)	5
HinP1I	GCGC	1 cut(s)	5
HinfI	GANTC	2 cut(s)	128, 492
HpaII	CCGG	1 cut(s)	473
Hpy188I	TCNGA	1 cut(s)	133
Hpy188III	TCNNGA	3 cut(s)	119, 227, 316
HpyCH4V	TGCA	3 cut(s)	142, 157, 239
HpyF3I	CTNAG	1 cut(s)	368
Hsp92I	GRCGYC	1 cut(s)	5
Hsp92II	CATG	2 cut(s)	157, 499
HspAI	GCGC	1 cut(s)	5
KasI	GGCGCC	1 cut(s)	4
KflI	GGGWCCC	1 cut(s)	172
Kzo9I	GATC	5 cut(s)	90, 181, 205, 280, 430
LpnPI	CCDG	7 cut(s)	55, 189, 225, 292, 371, 416, 486
MalI	GATC	5 cut(s)	92, 183, 207, 282, 432
MboI	GATC	5 cut(s)	90, 181, 205, 280, 430
MboII	GAAGA	3 cut(s)	116, 257, 275
MflI	RGATCY	2 cut(s)	181, 280
MluCI	AATT	6 cut(s)	47, 161, 230, 341, 348, 486
Mly113I	GGCGCC	1 cut(s)	5
MnlI	CCTC	1 cut(s)	100
MseI	TTAA	1 cut(s)	347
MspI	CCGG	1 cut(s)	473
MspR9I	CCNGG	1 cut(s)	473
NarI	GGCGCC	1 cut(s)	5
NciI	CCSGG	1 cut(s)	473
NdeII	GATC	5 cut(s)	90, 181, 205, 280, 430
NlaIII	CATG	2 cut(s)	157, 499
NlaIV	GGNNCC	5 cut(s)	6, 151, 173, 174, 183
NspV	TTCGAA	1 cut(s)	339
PfeI	GAWTC	2 cut(s)	128, 492
PfoI	TCCNGGA	1 cut(s)	471
PluTI	GGCGCC	1 cut(s)	8
PpuMI	RGGWCCY	1 cut(s)	172
Psp5II	RGGWCCY	1 cut(s)	172
PspN4I	GGNNCC	5 cut(s)	6, 151, 173, 174, 183
PspPI	GGNCC	2 cut(s)	39, 172
PspPPI	RGGWCCY	1 cut(s)	172
PsuI	RGATCY	2 cut(s)	181, 280
RsaI	GTAC	1 cut(s)	335
RsaNI	GTAC	1 cut(s)	334
SaqAI	TTAA	1 cut(s)	347
Sau3AI	GATC	5 cut(s)	90, 181, 205, 280, 430
Sau96I	GGNCC	2 cut(s)	39, 172
ScrFI	CCNGG	1 cut(s)	473
SetI	ASST	2 cut(s)	74, 335
SfoI	GGCGCC	1 cut(s)	6
SfuI	TTCGAA	1 cut(s)	339
SinI	GGWCC	1 cut(s)	172
Sse9I	AATT	6 cut(s)	47, 161, 230, 341, 348, 486
SsiI	CCGC	2 cut(s)	88, 179
SspDI	GGCGCC	1 cut(s)	4
StyD4I	CCNGG	1 cut(s)	471
StyI	CCWWGG	1 cut(s)	8
TaqI	TCGA	3 cut(s)	33, 226, 339
TasI	AATT	6 cut(s)	47, 161, 230, 341, 348, 486
TfiI	GAWTC	2 cut(s)	128, 492
Tru1I	TTAA	1 cut(s)	347
Tru9I	TTAA	1 cut(s)	347
TspDTI	ATGAA	9 cut(s)	60, 117, 154, 258, 341, 372, 484, 492, 497
TspGWI	ACGGA	2 cut(s)	293, 432
VpaK11BI	GGWCC	1 cut(s)	172
XapI	RAATTY	1 cut(s)	230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.