MD15G1364300.v1.1

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0001704
Physical Location & Seq
Reverse (-)
44128940 .. 44129098
159 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1364300.v1.1.491

Sequence Viewer

Length: 159 bp
ATGATTGACTCATTCCATACTAGAAATAATCGCAGGAAATCTTTTGATAACATGGATTCCTATTTCTCATTGATATCCCACGATCAAGACAATTGGCTGAATCCCGTGAAACCATTTCATAGAAGTTCATTGATATCTTCTTTTTGTAAAGCAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

53

Amino Acids

6.21

Weight (kDa)

9.1

Isoelectric Point (pI)

56.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 52 3.2e-28 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
BfaI CTAG 1 cut(s) 21
Bsp143I GATC 1 cut(s) 82
BssMI GATC 1 cut(s) 82
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
CviAII CATG 1 cut(s) 52
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eco32I GATATC 2 cut(s) 75, 135
EcoRV GATATC 2 cut(s) 75, 135
FaeI CATG 1 cut(s) 55
FaiI YATR 3 cut(s) 18, 53, 120
FatI CATG 1 cut(s) 51
FspBI CTAG 1 cut(s) 21
Hin1II CATG 1 cut(s) 55
HinfI GANTC 3 cut(s) 8, 56, 100
Hpy188III TCNNGA 1 cut(s) 86
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 19
MaeI CTAG 1 cut(s) 21
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 129
MfeI CAATTG 1 cut(s) 91
MluCI AATT 2 cut(s) 91, 154
MlyI GAGTC 1 cut(s) 2
MunI CAATTG 1 cut(s) 91
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 55
PfeI GAWTC 2 cut(s) 56, 100
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
Sau3AI GATC 1 cut(s) 82
SchI GAGTC 1 cut(s) 2
SgeI CNNG 7 cut(s) 33, 46, 64, 92, 98, 116, 118
Sse9I AATT 2 cut(s) 91, 154
SspMI CTAG 1 cut(s) 21
TasI AATT 2 cut(s) 91, 154
TfiI GAWTC 2 cut(s) 56, 100
TspDTI ATGAA 2 cut(s) 107, 117
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.