pycom13g12670

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0001704
Physical Location & Seq
Forward (+)
8888151 .. 8888336
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g12670.1

Sequence Viewer

Length: 186 bp
ATGCTTGAATCTAACTGGAGTTCGCGGTGGTGGAGGAACTGGATCGGAAAAAAGAGGGCTTCTAGTTGTAAGATATCTAATGAAACCGTCGCTGGAATTGAGATCTCATTCAAAGAGAAAGAGAATGTATATTCTTCCTCCAATTTTTCATTGAGAGGGAAAGGATTAAATCCTTTTAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

62

Amino Acids

7.1

Weight (kDa)

10.1

Isoelectric Point (pI)

46.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 45 6.1e-21 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 25
AciI CCGC 1 cut(s) 25
AclWI GGATC 1 cut(s) 50
AgsI TTSAA 2 cut(s) 8, 112
AlwI GGATC 1 cut(s) 50
BfaI CTAG 1 cut(s) 63
BglII AGATCT 1 cut(s) 102
BpmI CTGGAG 1 cut(s) 37
Bse1I ACTGG 2 cut(s) 20, 44
BseNI ACTGG 2 cut(s) 20, 44
Bsh1236I CGCG 1 cut(s) 25
Bsp143I GATC 2 cut(s) 42, 102
BspACI CCGC 1 cut(s) 25
BspFNI CGCG 1 cut(s) 25
BspPI GGATC 1 cut(s) 50
BsrI ACTGG 2 cut(s) 20, 44
BssMI GATC 2 cut(s) 42, 102
Bst4CI ACNGT 1 cut(s) 88
BstFNI CGCG 1 cut(s) 25
BstKTI GATC 2 cut(s) 45, 105
BstMBI GATC 2 cut(s) 42, 102
BstUI CGCG 1 cut(s) 25
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DpnI GATC 2 cut(s) 44, 104
DpnII GATC 2 cut(s) 42, 102
Eco32I GATATC 1 cut(s) 75
EcoRV GATATC 1 cut(s) 75
FaiI YATR 1 cut(s) 130
FspBI CTAG 1 cut(s) 63
GsuI CTGGAG 1 cut(s) 37
HinfI GANTC 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 47
Hpy99I CGWCG 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 88
Kzo9I GATC 2 cut(s) 42, 102
LpnPI CCDG 2 cut(s) 25, 78
MaeI CTAG 1 cut(s) 63
MalI GATC 2 cut(s) 44, 104
MboI GATC 2 cut(s) 42, 102
MboII GAAGA 1 cut(s) 126
MflI RGATCY 1 cut(s) 102
MluCI AATT 2 cut(s) 96, 142
MnlI CCTC 4 cut(s) 27, 48, 148, 149
MseI TTAA 2 cut(s) 167, 177
MvnI CGCG 1 cut(s) 25
NdeII GATC 2 cut(s) 42, 102
PfeI GAWTC 1 cut(s) 8
PsuI RGATCY 1 cut(s) 102
SaqAI TTAA 2 cut(s) 167, 177
Sau3AI GATC 2 cut(s) 42, 102
SgeI CNNG 6 cut(s) 17, 28, 36, 52, 75, 105
Sse9I AATT 2 cut(s) 96, 142
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 63
TaaI ACNGT 1 cut(s) 88
TasI AATT 2 cut(s) 96, 142
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 2 cut(s) 167, 177
Tru9I TTAA 2 cut(s) 167, 177
TspDTI ATGAA 2 cut(s) 96, 138
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.