MD17G1047400.v1.1

Mitochondrial outer membrane protein porin of 34

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
3453349 .. 3454837
1489 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1047400.v1.1.491

Sequence Viewer

Length: 252 bp
ATGGTGGGACCTGGGCTTTACACCGACATCGGCAAGAAAGCCAGAGATCTTCTGTACAAGGATTACCAGAGCGACAAGAAGTTCACCATCACTACCTTCTCTCCCACTGGAGTGGCTATCACCACTTCAGGAACCAACAAAGGTGAGCTTTTTCTGGGTGATGTGAACACTCAATTGAAAAACAAGAACGTCACAACTGATATCAAAGTTGACACCGACTCCAATGTAACTGTCCACCACTATTACGGTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.15

Weight (kDa)

7.95

Isoelectric Point (pI)

15.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Porin_3 PF01459 3 - 78 3.2e-19 Eukaryotic porin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 111
AfaI GTAC 1 cut(s) 56
AgsI TTSAA 1 cut(s) 178
AjnI CCWGG 1 cut(s) 10
AleI CACNNNNGTG 1 cut(s) 110
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 4 cut(s) 76, 112, 155, 170
AvaII GGWCC 1 cut(s) 8
BccI CCATC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 12
BglII AGATCT 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 2 cut(s) 9, 133
BmrFI CCNGG 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 11
BsaXI ACNNNNNCTCC 4 cut(s) 85, 115, 203, 233
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 112
BslFI GGGAC 1 cut(s) 21
BsmFI GGGAC 1 cut(s) 21
Bsp1407I TGTACA 1 cut(s) 54
Bsp143I GATC 1 cut(s) 46
BspLI GGNNCC 2 cut(s) 9, 133
BsrGI TGTACA 1 cut(s) 54
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 232, 248
BstAUI TGTACA 1 cut(s) 54
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 46
BstXI CCANNNNNNTGG 1 cut(s) 112
BstYI RGATCY 1 cut(s) 46
BtsIMutI CAGTG 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 8
Csp6I GTAC 1 cut(s) 55
CviJI RGCY 4 cut(s) 16, 41, 116, 148
CviKI_1 RGCY 4 cut(s) 16, 41, 116, 148
CviQI GTAC 1 cut(s) 55
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco32I GATATC 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 8
Eco57I CTGAAG 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 10
EcoRV GATATC 1 cut(s) 202
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FaqI GGGAC 1 cut(s) 21
GsuI CTGGAG 1 cut(s) 129
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HinfI GANTC 1 cut(s) 218
HphI GGTGA 4 cut(s) 76, 112, 155, 170
Hpy166II GTNNAC 4 cut(s) 84, 166, 211, 235
Hpy188III TCNNGA 1 cut(s) 129
Hpy8I GTNNAC 4 cut(s) 84, 166, 211, 235
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 2 cut(s) 232, 248
HpyCH4IV ACGT 1 cut(s) 189
HpySE526I ACGT 1 cut(s) 189
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 6 cut(s) 24, 55, 80, 93, 114, 140
MaeII ACGT 1 cut(s) 189
MaeIII GTNAC 2 cut(s) 190, 226
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 41
MfeI CAATTG 1 cut(s) 173
MflI RGATCY 1 cut(s) 46
MluCI AATT 1 cut(s) 173
MlyI GAGTC 1 cut(s) 212
MslI CAYNNNNRTG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 12
MunI CAATTG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 12
NdeII GATC 1 cut(s) 46
NlaIV GGNNCC 2 cut(s) 9, 133
NmuCI GTSAC 1 cut(s) 190
OliI CACNNNNGTG 1 cut(s) 110
PleI GAGTC 1 cut(s) 212
PpsI GAGTC 1 cut(s) 212
PpuMI RGGWCCY 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
PspN4I GGNNCC 2 cut(s) 9, 133
PspPI GGNCC 1 cut(s) 8
PspPPI RGGWCCY 1 cut(s) 8
PsuI RGATCY 1 cut(s) 46
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 110
Sau3AI GATC 1 cut(s) 46
Sau96I GGNCC 1 cut(s) 8
SchI GAGTC 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 12
SetI ASST 5 cut(s) 13, 98, 145, 150, 192
SinI GGWCC 1 cut(s) 8
SmiMI CAYNNNNRTG 1 cut(s) 110
Sse9I AATT 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 2 cut(s) 232, 248
TaiI ACGT 1 cut(s) 192
TasI AATT 1 cut(s) 173
TatI WGTACW 1 cut(s) 54
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspRI CASTG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.