Prupe.4G021600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
1025816 .. 1026586
771 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G021600.1

Sequence Viewer

Length: 450 bp
ATGGGAAACTGTTTGAGGCGTGATTCGGCCACGGTATGGGCCGACGACGACGATGACGACGACTGGGTCGACATTAGTTCTCAGCTGCAGGTGCAGCCTTGTGATGATTGTAATAATAGTAATAATAATAAGAAGAAGAAGGCTTACAACCACTTGGTCGAAAAGCAGAGGCTTCTTGGTGAGATAATATCATCAGCTTCAACATCTTCAACATCTTCAACATCTTCAACATCTTCAACTTCAACTAATGGAGATCAGGTGAAGATCAAGATTACTAAGAAGGAGCTGGATGAGTTGGTGCATGGAGGAAACCTGCAAGGTCTTTCGTCTGTCGAACAACTCTTAGATCGCCTCTTGACAATGAACGGCCCTGATGACGATCAGAACTTCTATGAGATGGATCATCAACGGCCCTGGAGGCCAGTCCTCCAAACTATTCCAGAGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

16.73

Weight (kDa)

4.58

Isoelectric Point (pI)

35.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 79
AasI GACNNNNNNGTC 1 cut(s) 65
Acc36I ACCTGC 2 cut(s) 79, 321
AccB7I CCANNNNNTGG 1 cut(s) 36
AccI GTMKAC 1 cut(s) 69
AclWI GGATC 1 cut(s) 408
AcoI YGGCCR 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 6 cut(s) 201, 210, 219, 228, 237, 243
AjnI CCWGG 1 cut(s) 413
AluBI AGCT 3 cut(s) 85, 197, 286
AluI AGCT 3 cut(s) 85, 197, 286
AlwI GGATC 1 cut(s) 408
AoxI GGCC 5 cut(s) 27, 39, 367, 410, 419
ApeKI GCWGC 2 cut(s) 85, 94
AspS9I GGNCC 3 cut(s) 39, 368, 411
AsuHPI GGTGA 2 cut(s) 191, 271
BarI GAAGNNNNNNTAC 2 cut(s) 128, 160
BbvI GCAGC 2 cut(s) 72, 106
BccI CCATC 1 cut(s) 391
BceAI ACGGC 2 cut(s) 382, 425
BciT130I CCWGG 1 cut(s) 415
BfmI CTRYAG 1 cut(s) 86
BfuAI ACCTGC 2 cut(s) 79, 321
BglI GCCNNNNNGGC 1 cut(s) 418
BisI GCNGC 2 cut(s) 86, 95
BlsI GCNGC 2 cut(s) 87, 96
Bme1390I CCNGG 1 cut(s) 415
BmgT120I GGNCC 3 cut(s) 39, 368, 411
BmrFI CCNGG 1 cut(s) 415
BmrI ACTGGG 1 cut(s) 73
BmuI ACTGGG 1 cut(s) 73
BpmI CTGGAG 1 cut(s) 436
BsaBI GATNNNNATC 1 cut(s) 378
BsaJI CCNNGG 2 cut(s) 30, 413
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse1I ACTGG 2 cut(s) 68, 422
Bse8I GATNNNNATC 1 cut(s) 378
BseBI CCWGG 1 cut(s) 415
BseDI CCNNGG 2 cut(s) 30, 413
BseGI GGATG 1 cut(s) 295
BseJI GATNNNNATC 1 cut(s) 378
BseLI CCNNNNNNNGG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 95
BseNI ACTGG 2 cut(s) 68, 422
BseXI GCAGC 2 cut(s) 72, 106
BsgI GTGCAG 1 cut(s) 113
BshFI GGCC 5 cut(s) 29, 41, 369, 412, 421
BslI CCNNNNNNNGG 1 cut(s) 36
BsnI GGCC 5 cut(s) 29, 41, 369, 412, 421
Bsp143I GATC 5 cut(s) 253, 264, 346, 379, 400
BspANI GGCC 5 cut(s) 29, 41, 369, 412, 421
BspCNI CTCAG 1 cut(s) 94
BspMAI CTGCAG 1 cut(s) 90
BspMI ACCTGC 2 cut(s) 79, 321
BspPI GGATC 1 cut(s) 408
BsrI ACTGG 2 cut(s) 68, 422
BssECI CCNNGG 2 cut(s) 30, 413
BssMI GATC 5 cut(s) 253, 264, 346, 379, 400
Bst2UI CCWGG 1 cut(s) 415
Bst4CI ACNGT 2 cut(s) 11, 34
BstDEI CTNAG 3 cut(s) 81, 276, 343
BstDSI CCRYGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 295
BstKTI GATC 5 cut(s) 256, 267, 349, 382, 403
BstMBI GATC 5 cut(s) 253, 264, 346, 379, 400
BstMWI GCNNNNNNNGC 3 cut(s) 91, 94, 418
BstNI CCWGG 1 cut(s) 415
BstSCI CCNGG 1 cut(s) 413
BstSFI CTRYAG 1 cut(s) 86
BstV1I GCAGC 2 cut(s) 72, 106
BsuRI GGCC 5 cut(s) 29, 41, 369, 412, 421
BtgI CCRYGG 1 cut(s) 30
BtsCI GGATG 1 cut(s) 295
BveI ACCTGC 2 cut(s) 79, 321
Cfr13I GGNCC 3 cut(s) 39, 368, 411
CviAII CATG 1 cut(s) 302
DdeI CTNAG 3 cut(s) 81, 276, 343
DpnI GATC 5 cut(s) 255, 266, 348, 381, 402
DpnII GATC 5 cut(s) 253, 264, 346, 379, 400
DrdI GACNNNNNNGTC 1 cut(s) 65
DseDI GACNNNNNNGTC 1 cut(s) 65
EaeI YGGCCR 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 413
FaeI CATG 1 cut(s) 305
FaiI YATR 3 cut(s) 37, 303, 393
FatI CATG 1 cut(s) 301
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 2 cut(s) 86, 95
FokI GGATG 1 cut(s) 302
Fsp4HI GCNGC 2 cut(s) 86, 95
GluI GCNGC 2 cut(s) 86, 95
GsuI CTGGAG 1 cut(s) 436
HaeIII GGCC 5 cut(s) 29, 41, 369, 412, 421
Hin1II CATG 1 cut(s) 305
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 1 cut(s) 23
HphI GGTGA 2 cut(s) 191, 271
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 384
Hpy188III TCNNGA 3 cut(s) 268, 355, 440
Hpy8I GTNNAC 1 cut(s) 70
Hpy99I CGWCG 4 cut(s) 47, 50, 53, 62
HpyAV CCTTC 2 cut(s) 133, 274
HpyCH4III ACNGT 2 cut(s) 11, 34
HpyCH4V TGCA 4 cut(s) 88, 94, 301, 316
HpyF10VI GCNNNNNNNGC 3 cut(s) 91, 94, 418
HpyF3I CTNAG 3 cut(s) 81, 276, 343
Hsp92II CATG 1 cut(s) 305
Kzo9I GATC 5 cut(s) 253, 264, 346, 379, 400
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 9 cut(s) 49, 74, 242, 272, 326, 384, 400, 427, 435
Lsp1109I GCAGC 2 cut(s) 72, 106
MalI GATC 5 cut(s) 255, 266, 348, 381, 402
MboI GATC 5 cut(s) 253, 264, 346, 379, 400
MboII GAAGA 7 cut(s) 145, 148, 198, 207, 216, 225, 274
MnlI CCTC 6 cut(s) 9, 162, 299, 362, 411, 437
MseI TTAA 1 cut(s) 448
MspA1I CMGCKG 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 415
MvaI CCWGG 1 cut(s) 415
MwoI GCNNNNNNNGC 3 cut(s) 91, 94, 418
NdeII GATC 5 cut(s) 253, 264, 346, 379, 400
NlaIII CATG 1 cut(s) 305
PaqCI CACCTGC 1 cut(s) 79
PcsI WCGNNNNNNNCGW 3 cut(s) 54, 57, 66
PfeI GAWTC 1 cut(s) 23
PflFI GACNNNGTC 1 cut(s) 65
PflMI CCANNNNNTGG 1 cut(s) 36
PkrI GCNGC 2 cut(s) 87, 96
Psp6I CCWGG 1 cut(s) 413
PspGI CCWGG 1 cut(s) 413
PspPI GGNCC 3 cut(s) 39, 368, 411
PstI CTGCAG 1 cut(s) 90
PsyI GACNNNGTC 1 cut(s) 65
PvuII CAGCTG 1 cut(s) 85
SalI GTCGAC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 448
SatI GCNGC 2 cut(s) 86, 95
Sau3AI GATC 5 cut(s) 253, 264, 346, 379, 400
Sau96I GGNCC 3 cut(s) 39, 368, 411
ScrFI CCNGG 1 cut(s) 415
SetI ASST 7 cut(s) 87, 93, 199, 261, 288, 315, 322
SfcI CTRYAG 1 cut(s) 86
SfiI GGCCNNNNNGGCC 1 cut(s) 418
StyD4I CCNGG 1 cut(s) 413
TaaI ACNGT 2 cut(s) 11, 34
TaqI TCGA 3 cut(s) 69, 159, 333
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 1 cut(s) 448
Tru9I TTAA 1 cut(s) 448
TseI GCWGC 2 cut(s) 85, 94
TspDTI ATGAA 1 cut(s) 377
Tth111I GACNNNGTC 1 cut(s) 65
Van91I CCANNNNNTGG 1 cut(s) 36
XmiI GTMKAC 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.