pycom10g27120

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
28186742 .. 28187092
351 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g27120.1

Sequence Viewer

Length: 351 bp
ATGGGAAACTGTTTGAGACGCGATTCCGCGACGGTATGGGCCGGAGACGACGACTGGATTGATGTTTCTCAGCTTGAGCCTGATGCTAAAATGGCACACAACCCAGAAAGGCATAGGCTTCTTGGCGAGATAAGATCATATTCATCATCTGCAGCCTCAACACCTTCATTTTCTACTAGCACTAGTAGTACTGGAGGAGATCAAGTGAAGATCAAGATGACTAAGAAGGAGCTGGAGGAGTTGGTAAAAGGAGGAGGAAACATGCAGGGTCTGTCGTCTGTGGAACAGCTATTGGCTCGGCTCGGGATCAACGGCCTTGACGATCATGATCAGTACTATGATCGATCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

12.72

Weight (kDa)

5.07

Isoelectric Point (pI)

49.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 21, 29
AciI CCGC 1 cut(s) 27
AclWI GGATC 1 cut(s) 314
AfaI GTAC 2 cut(s) 190, 335
AhlI ACTAGT 1 cut(s) 182
AluBI AGCT 3 cut(s) 73, 232, 289
AluI AGCT 3 cut(s) 73, 232, 289
Alw26I GTCTC 2 cut(s) 10, 39
AlwI GGATC 1 cut(s) 314
AlwNI CAGNNNCTG 1 cut(s) 271
Ama87I CYCGRG 1 cut(s) 302
AoxI GGCC 2 cut(s) 39, 313
ApeKI GCWGC 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 39
AvaI CYCGRG 1 cut(s) 302
BbvI GCAGC 1 cut(s) 164
BceAI ACGGC 1 cut(s) 328
BclI TGATCA 1 cut(s) 328
BcoDI GTCTC 2 cut(s) 10, 39
BcuI ACTAGT 1 cut(s) 182
BfaI CTAG 2 cut(s) 177, 183
BfmI CTRYAG 1 cut(s) 150
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
BmcAI AGTACT 2 cut(s) 190, 335
BmeT110I CYCGRG 1 cut(s) 302
BmgT120I GGNCC 1 cut(s) 39
BmsI GCATC 1 cut(s) 73
BpmI CTGGAG 2 cut(s) 213, 254
BpuEI CTTGAG 1 cut(s) 95
Bsa29I ATCGAT 1 cut(s) 343
BsaBI GATNNNNATC 1 cut(s) 327
BsaXI ACNNNNNCTCC 2 cut(s) 189, 219
Bse1I ACTGG 2 cut(s) 59, 196
Bse8I GATNNNNATC 1 cut(s) 327
BseCI ATCGAT 1 cut(s) 343
BseJI GATNNNNATC 1 cut(s) 327
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 2 cut(s) 59, 196
BseRI GAGGAG 3 cut(s) 210, 251, 267
BseXI GCAGC 1 cut(s) 164
Bsh1236I CGCG 2 cut(s) 21, 29
Bsh1285I CGRYCG 1 cut(s) 347
BshFI GGCC 2 cut(s) 41, 315
BshVI ATCGAT 1 cut(s) 343
BsiEI CGRYCG 1 cut(s) 347
BsiHKCI CYCGRG 1 cut(s) 302
BsiSI CCGG 1 cut(s) 42
BsmAI GTCTC 2 cut(s) 10, 39
BsmBI CGTCTC 2 cut(s) 10, 39
BsnI GGCC 2 cut(s) 41, 315
BsoBI CYCGRG 1 cut(s) 302
Bsp143I GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
BspACI CCGC 1 cut(s) 27
BspANI GGCC 2 cut(s) 41, 315
BspCNI CTCAG 1 cut(s) 82
BspDI ATCGAT 1 cut(s) 343
BspFNI CGCG 2 cut(s) 21, 29
BspHI TCATGA 1 cut(s) 325
BspMAI CTGCAG 1 cut(s) 154
BspPI GGATC 1 cut(s) 314
BsrI ACTGG 2 cut(s) 59, 196
BssMI GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
Bst4CI ACNGT 2 cut(s) 11, 34
BstDEI CTNAG 2 cut(s) 69, 222
BstFNI CGCG 2 cut(s) 21, 29
BstKTI GATC 8 cut(s) 137, 202, 213, 309, 325, 331, 343, 347
BstMAI GTCTC 2 cut(s) 10, 39
BstMBI GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
BstMCI CGRYCG 1 cut(s) 347
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 265
BstSFI CTRYAG 1 cut(s) 150
BstUI CGCG 2 cut(s) 21, 29
BstV1I GCAGC 1 cut(s) 164
Bsu15I ATCGAT 1 cut(s) 343
BsuRI GGCC 2 cut(s) 41, 315
BsuTUI ATCGAT 1 cut(s) 343
CaiI CAGNNNCTG 1 cut(s) 271
CciI TCATGA 1 cut(s) 325
Cfr13I GGNCC 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 343
CseI GACGC 1 cut(s) 27
Csp6I GTAC 2 cut(s) 189, 334
CviAII CATG 2 cut(s) 262, 326
CviQI GTAC 2 cut(s) 189, 334
DdeI CTNAG 2 cut(s) 69, 222
DpnI GATC 8 cut(s) 136, 201, 212, 308, 324, 330, 342, 346
DpnII GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
Eco88I CYCGRG 1 cut(s) 302
Esp3I CGTCTC 2 cut(s) 10, 39
FaeI CATG 2 cut(s) 265, 329
FaiI YATR 6 cut(s) 37, 114, 139, 263, 327, 339
FatI CATG 2 cut(s) 261, 325
FbaI TGATCA 1 cut(s) 328
Fnu4HI GCNGC 1 cut(s) 153
Fsp4HI GCNGC 1 cut(s) 153
FspBI CTAG 2 cut(s) 177, 183
GluI GCNGC 1 cut(s) 153
GsuI CTGGAG 2 cut(s) 213, 254
HaeIII GGCC 2 cut(s) 41, 315
HapII CCGG 1 cut(s) 42
HgaI GACGC 1 cut(s) 27
Hin1II CATG 2 cut(s) 265, 329
HinfI GANTC 1 cut(s) 23
HpaII CCGG 1 cut(s) 42
Hpy188III TCNNGA 4 cut(s) 214, 304, 326, 348
Hpy99I CGWCG 2 cut(s) 34, 53
HpyAV CCTTC 2 cut(s) 174, 220
HpyCH4III ACNGT 2 cut(s) 11, 34
HpyCH4V TGCA 2 cut(s) 152, 265
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpyF3I CTNAG 2 cut(s) 69, 222
Hsp92II CATG 2 cut(s) 265, 329
Ksp22I TGATCA 1 cut(s) 328
Kzo9I GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 7 cut(s) 40, 55, 93, 117, 177, 218, 251
Lsp1109I GCAGC 1 cut(s) 164
LweI GCATC 1 cut(s) 73
MaeI CTAG 2 cut(s) 177, 183
MalI GATC 8 cut(s) 136, 201, 212, 308, 324, 330, 342, 346
MboI GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
MboII GAAGA 1 cut(s) 220
MnlI CCTC 5 cut(s) 166, 188, 229, 245, 248
MspI CCGG 1 cut(s) 42
MvnI CGCG 2 cut(s) 21, 29
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
NlaIII CATG 2 cut(s) 265, 329
NmeAIII GCCGAG 1 cut(s) 277
NspI RCATGY 1 cut(s) 265
PagI TCATGA 1 cut(s) 325
PcsI WCGNNNNNNNCGW 1 cut(s) 318
PfeI GAWTC 1 cut(s) 23
PkrI GCNGC 1 cut(s) 154
Ple19I CGATCG 1 cut(s) 347
PspPI GGNCC 1 cut(s) 39
PstI CTGCAG 1 cut(s) 154
PstNI CAGNNNCTG 1 cut(s) 271
PvuI CGATCG 1 cut(s) 347
RsaI GTAC 2 cut(s) 190, 335
RsaNI GTAC 2 cut(s) 189, 334
SatI GCNGC 1 cut(s) 153
Sau3AI GATC 8 cut(s) 134, 199, 210, 306, 322, 328, 340, 344
Sau96I GGNCC 1 cut(s) 39
ScaI AGTACT 2 cut(s) 190, 335
SetI ASST 4 cut(s) 75, 166, 234, 291
SfaNI GCATC 1 cut(s) 73
SfcI CTRYAG 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SpeI ACTAGT 1 cut(s) 182
SsiI CCGC 1 cut(s) 27
SspMI CTAG 2 cut(s) 177, 183
TaaI ACNGT 2 cut(s) 11, 34
TaqI TCGA 1 cut(s) 343
TatI WGTACW 2 cut(s) 188, 333
TfiI GAWTC 1 cut(s) 23
TseI GCWGC 1 cut(s) 152
TspDTI ATGAA 2 cut(s) 132, 156
XceI RCATGY 1 cut(s) 265
XspI CTAG 2 cut(s) 177, 183
ZrmI AGTACT 2 cut(s) 190, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.