pycom05g31410

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0003392
Physical Location & Seq
Reverse (-)
31155954 .. 31156364
411 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g31410.1

Sequence Viewer

Length: 411 bp
ATGGGAAACTGCTTGAGGCGCGATTCCGCGATGGTATGGGCCGGAGACGACAACTGGATTGACGTTTCTCAGCTTCAGCCTGATGATAAAAGTGCACACAACCCAGAAAAGCATAGGCTTCTTGGTGAGATAAGATCATATTCATCATCTGGAGCTCCAACATCTTCATTTTCTACTAGTACTAGTAGTATTGGAGGAGATCAAGTGAAGATCAAGATTAGTAAGAAAGAGCTGGAGGAGTTGGTAAAAGGAGGAGGAAACATGCAGGGTCTTTCGTCTGTGGAACAGCTATTAACTTGGGTCATGATCAACGGCCGTGATGGTCATGATCAGTACTATGATGTTCGTGATGAGATGGACCGTCAACGGCCCTGGAGTCCTGTTCTCCAAAGTATTCCGGAAGTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.18

Weight (kDa)

5.12

Isoelectric Point (pI)

48.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 21, 29
AccIII TCCGGA 1 cut(s) 397
AciI CCGC 1 cut(s) 27
AcoI YGGCCR 1 cut(s) 313
AcuI CTGAAG 1 cut(s) 59
AfaI GTAC 2 cut(s) 181, 335
AhlI ACTAGT 2 cut(s) 176, 182
AjnI CCWGG 1 cut(s) 371
AluBI AGCT 4 cut(s) 73, 155, 232, 289
AluI AGCT 4 cut(s) 73, 155, 232, 289
Alw21I GWGCWC 2 cut(s) 97, 157
Alw26I GTCTC 1 cut(s) 39
Alw44I GTGCAC 1 cut(s) 93
Aor13HI TCCGGA 1 cut(s) 397
AoxI GGCC 3 cut(s) 39, 313, 368
ApaLI GTGCAC 1 cut(s) 93
AspLEI GCGC 1 cut(s) 21
AspS9I GGNCC 3 cut(s) 39, 358, 369
AsuHPI GGTGA 1 cut(s) 137
AvaII GGWCC 1 cut(s) 358
BaeGI GKGCMC 1 cut(s) 97
BanII GRGCYC 1 cut(s) 157
Bbv12I GWGCWC 2 cut(s) 97, 157
BccI CCATC 3 cut(s) 25, 314, 349
BceAI ACGGC 3 cut(s) 300, 328, 383
BciT130I CCWGG 1 cut(s) 373
BclI TGATCA 2 cut(s) 306, 328
BcoDI GTCTC 1 cut(s) 39
BcuI ACTAGT 2 cut(s) 176, 182
BfaI CTAG 2 cut(s) 177, 183
BmcAI AGTACT 2 cut(s) 181, 335
Bme1390I CCNGG 1 cut(s) 373
Bme18I GGWCC 1 cut(s) 358
BmgT120I GGNCC 3 cut(s) 39, 358, 369
BmrFI CCNGG 1 cut(s) 373
BpmI CTGGAG 3 cut(s) 171, 254, 394
BpuEI CTTGAG 1 cut(s) 34
BsaJI CCNNGG 1 cut(s) 371
BsaWI WCCGGW 1 cut(s) 397
BsaXI ACNNNNNCTCC 2 cut(s) 189, 219
Bse1I ACTGG 1 cut(s) 59
BseAI TCCGGA 1 cut(s) 397
BseBI CCWGG 1 cut(s) 373
BseDI CCNNGG 1 cut(s) 371
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 59
BseRI GAGGAG 3 cut(s) 210, 251, 267
BseSI GKGCMC 1 cut(s) 97
BseX3I CGGCCG 1 cut(s) 313
Bsh1236I CGCG 2 cut(s) 21, 29
Bsh1285I CGRYCG 1 cut(s) 316
BshFI GGCC 3 cut(s) 41, 315, 370
BsiEI CGRYCG 1 cut(s) 316
BsiHKAI GWGCWC 2 cut(s) 97, 157
BsiSI CCGG 2 cut(s) 42, 398
BsmAI GTCTC 1 cut(s) 39
BsmBI CGTCTC 1 cut(s) 39
BsnI GGCC 3 cut(s) 41, 315, 370
Bsp1286I GDGCHC 2 cut(s) 97, 157
Bsp13I TCCGGA 1 cut(s) 397
Bsp143I GATC 5 cut(s) 134, 199, 210, 306, 328
BspACI CCGC 1 cut(s) 27
BspANI GGCC 3 cut(s) 41, 315, 370
BspCNI CTCAG 1 cut(s) 82
BspEI TCCGGA 1 cut(s) 397
BspFNI CGCG 2 cut(s) 21, 29
BspHI TCATGA 2 cut(s) 303, 325
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 371
BssMI GATC 5 cut(s) 134, 199, 210, 306, 328
Bst2UI CCWGG 1 cut(s) 373
Bst4CI ACNGT 1 cut(s) 362
BstDEI CTNAG 1 cut(s) 69
BstFNI CGCG 2 cut(s) 21, 29
BstHHI GCGC 1 cut(s) 21
BstKTI GATC 5 cut(s) 137, 202, 213, 309, 331
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 5 cut(s) 134, 199, 210, 306, 328
BstMCI CGRYCG 1 cut(s) 316
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 373
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 1 cut(s) 371
BstSLI GKGCMC 1 cut(s) 97
BstUI CGCG 2 cut(s) 21, 29
BstZI CGGCCG 1 cut(s) 313
BsuRI GGCC 3 cut(s) 41, 315, 370
BtgZI GCGATG 1 cut(s) 44
CciI TCATGA 2 cut(s) 303, 325
CfoI GCGC 1 cut(s) 21
Cfr13I GGNCC 3 cut(s) 39, 358, 369
Csp6I GTAC 2 cut(s) 180, 334
CviAII CATG 3 cut(s) 262, 304, 326
CviJI RGCY 9 cut(s) 41, 73, 79, 118, 155, 232, 289, 315, 370
CviKI_1 RGCY 9 cut(s) 41, 73, 79, 118, 155, 232, 289, 315, 370
CviQI GTAC 2 cut(s) 180, 334
DdeI CTNAG 1 cut(s) 69
DpnI GATC 5 cut(s) 136, 201, 212, 308, 330
DpnII GATC 5 cut(s) 134, 199, 210, 306, 328
EaeI YGGCCR 1 cut(s) 313
EagI CGGCCG 1 cut(s) 313
Ecl136II GAGCTC 1 cut(s) 155
EclXI CGGCCG 1 cut(s) 313
Eco24I GRGCYC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 358
Eco52I CGGCCG 1 cut(s) 313
Eco53kI GAGCTC 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 59
EcoICRI GAGCTC 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 371
EcoT38I GRGCYC 1 cut(s) 157
Esp3I CGTCTC 1 cut(s) 39
FaeI CATG 3 cut(s) 265, 307, 329
FaiI YATR 7 cut(s) 37, 114, 139, 263, 305, 327, 339
FatI CATG 3 cut(s) 261, 303, 325
FbaI TGATCA 2 cut(s) 306, 328
FriOI GRGCYC 1 cut(s) 157
FspBI CTAG 2 cut(s) 177, 183
GlaI GCGC 1 cut(s) 20
GsuI CTGGAG 3 cut(s) 171, 254, 394
HaeIII GGCC 3 cut(s) 41, 315, 370
HapII CCGG 2 cut(s) 42, 398
HhaI GCGC 1 cut(s) 21
Hin1II CATG 3 cut(s) 265, 307, 329
Hin6I GCGC 1 cut(s) 19
HinP1I GCGC 1 cut(s) 19
HincII GTYRAC 1 cut(s) 365
HindII GTYRAC 1 cut(s) 365
HinfI GANTC 2 cut(s) 23, 376
HpaII CCGG 2 cut(s) 42, 398
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 2 cut(s) 95, 365
Hpy188III TCNNGA 6 cut(s) 150, 214, 304, 326, 347, 398
Hpy8I GTNNAC 2 cut(s) 95, 365
HpyCH4III ACNGT 1 cut(s) 362
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 95, 265
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 3 cut(s) 265, 307, 329
HspAI GCGC 1 cut(s) 19
Kpn2I TCCGGA 1 cut(s) 397
Ksp22I TGATCA 2 cut(s) 306, 328
Kzo9I GATC 5 cut(s) 134, 199, 210, 306, 328
LmnI GCTCC 2 cut(s) 152, 160
MaeI CTAG 2 cut(s) 177, 183
MaeII ACGT 1 cut(s) 63
MalI GATC 5 cut(s) 136, 201, 212, 308, 330
MboI GATC 5 cut(s) 134, 199, 210, 306, 328
MboII GAAGA 2 cut(s) 156, 220
MhlI GDGCHC 2 cut(s) 97, 157
MluCI AATT 1 cut(s) 406
MlyI GAGTC 1 cut(s) 385
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 5 cut(s) 9, 188, 229, 245, 248
MroI TCCGGA 1 cut(s) 397
MseI TTAA 3 cut(s) 293, 405, 409
MspI CCGG 2 cut(s) 42, 398
MspR9I CCNGG 1 cut(s) 373
MvaI CCWGG 1 cut(s) 373
MvnI CGCG 2 cut(s) 21, 29
MwoI GCNNNNNNNGC 1 cut(s) 18
NdeII GATC 5 cut(s) 134, 199, 210, 306, 328
NlaIII CATG 3 cut(s) 265, 307, 329
NspI RCATGY 1 cut(s) 265
PacI TTAATTAA 1 cut(s) 409
PagI TCATGA 2 cut(s) 303, 325
PfeI GAWTC 1 cut(s) 23
PleI GAGTC 1 cut(s) 384
PpsI GAGTC 1 cut(s) 384
Psp124BI GAGCTC 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 371
PspGI CCWGG 1 cut(s) 371
PspPI GGNCC 3 cut(s) 39, 358, 369
RsaI GTAC 2 cut(s) 181, 335
RsaNI GTAC 2 cut(s) 180, 334
SacI GAGCTC 1 cut(s) 157
SaqAI TTAA 3 cut(s) 293, 405, 409
Sau3AI GATC 5 cut(s) 134, 199, 210, 306, 328
Sau96I GGNCC 3 cut(s) 39, 358, 369
ScaI AGTACT 2 cut(s) 181, 335
SchI GAGTC 1 cut(s) 385
ScrFI CCNGG 1 cut(s) 373
SduI GDGCHC 2 cut(s) 97, 157
SetI ASST 5 cut(s) 66, 75, 157, 234, 291
SinI GGWCC 1 cut(s) 358
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
SpeI ACTAGT 2 cut(s) 176, 182
Sse9I AATT 1 cut(s) 406
SsiI CCGC 1 cut(s) 27
SspMI CTAG 2 cut(s) 177, 183
SstI GAGCTC 1 cut(s) 157
StyD4I CCNGG 1 cut(s) 371
TaaI ACNGT 1 cut(s) 362
TaiI ACGT 1 cut(s) 66
TasI AATT 1 cut(s) 406
TatI WGTACW 2 cut(s) 179, 333
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 3 cut(s) 293, 405, 409
Tru9I TTAA 3 cut(s) 293, 405, 409
TspDTI ATGAA 2 cut(s) 132, 156
VneI GTGCAC 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 358
XceI RCATGY 1 cut(s) 265
XspI CTAG 2 cut(s) 177, 183
ZrmI AGTACT 2 cut(s) 181, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.