Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0004054

Physical Location & Seq

Genomic Coordinates Forward (+)

9888003 .. 9889428

Gene Structure 1426 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G169100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 285 bp

ATGTTTTACTGTCATTCGGTTTCCCAGTATCTTTCCTGTTACTGTATATGGTGTCTTTTTGTTGCTCTCTGTGGGCTGGTCCTGTGGCCATCATTTGATGTAATACTAGCAGATCAGGTTTCTCTCGTCATCCCAATGCTAAAGCTTAAGAAGACAACAAAGAAAAAAGTATGGCTGCAGGAATGGCAGACAAGACTCTTGTTAACAGCAAATTCACAGCATCTATGTTGGCAAAGACATTTAAGAATCTTAACGCATGAGGAATTCAGCCAGCTGTTAATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00510 ko00513 ko01100 map00510 map00513 map01100

Pfam Domains

Protein Families

Glyco_transf_4 Glycos_transf_1

Protein Analysis

95

Amino Acids

11.22

Weight (kDa)

8.84

Isoelectric Point (pI)

46.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004054)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G78800
fragaria_vesca	FvH4_3g18220 FvH4_3g18220
malus_domestica	MD00G1077500.v1.1 MD00G1078000.v1.1 MD03G1178900.v1.1 MD11G1264500.v1.1
prunus_persica	Prupe.4G169100_v2.0.a1 Prupe.4G241400_v2.0.a1 Prupe.4G241400_v2.0.a1 Prupe.4G241400_v2.0.a1 Prupe.5G052700_v2.0.a1 Prupe.5G052700_v2.0.a1 Prupe.5G052700_v2.0.a1 Prupe.5G052700_v2.0.a1 Prupe.5G052700_v2.0.a1 Prupe.5G052700_v2.0.a1
pyrus_communis	pycom11g23280
rosa_chinensis	RchiOBHm_Chr5g0030771
rosa_laevigata	RLG00000033250
rosa_multiflora	Rmu_sc0009742.1_g000012 Rmu_sc0021923.1_g000002
rosa_roxburghii	Rroxscaffold_1G00049550
rosa_rugosa	Rorug05G0120600 Rorug05G0120700
rosa_samantha	Rh1AG151000 Rh1CG142200 Rh5AG212700 Rh5BG212000 Rh5CG235200 Rh5DG216800
rosa_wichuraiana	Rw1G012370 Rw5G019480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	86
AcsI	RAATTY	2 cut(s)	211, 263
AflII	CTTAAG	1 cut(s)	146
AluBI	AGCT	2 cut(s)	145, 274
AluI	AGCT	2 cut(s)	145, 274
AoxI	GGCC	1 cut(s)	86
ApeKI	GCWGC	1 cut(s)	175
ApoI	RAATTY	2 cut(s)	211, 263
AspS9I	GGNCC	1 cut(s)	79
AvaII	GGWCC	1 cut(s)	79
BalI	TGGCCA	1 cut(s)	88
BbsI	GAAGAC	1 cut(s)	158
BbvI	GCAGC	1 cut(s)	162
BccI	CCATC	1 cut(s)	97
BfaI	CTAG	1 cut(s)	107
BfmI	CTRYAG	1 cut(s)	176
BfrI	CTTAAG	1 cut(s)	146
BisI	GCNGC	1 cut(s)	176
BlsI	GCNGC	1 cut(s)	177
Bme18I	GGWCC	1 cut(s)	79
BmgT120I	GGNCC	1 cut(s)	79
BmrI	ACTGGG	1 cut(s)	19
BmsI	GCATC	1 cut(s)	229
BmuI	ACTGGG	1 cut(s)	19
BpiI	GAAGAC	1 cut(s)	158
Bse1I	ACTGG	1 cut(s)	25
BseGI	GGATG	1 cut(s)	129
BseNI	ACTGG	1 cut(s)	25
BseXI	GCAGC	1 cut(s)	162
BshFI	GGCC	1 cut(s)	88
BsnI	GGCC	1 cut(s)	88
Bsp143I	GATC	1 cut(s)	112
BspANI	GGCC	1 cut(s)	88
BspMAI	CTGCAG	1 cut(s)	180
BspTI	CTTAAG	1 cut(s)	146
BsrI	ACTGG	1 cut(s)	25
BssMI	GATC	1 cut(s)	112
Bst4CI	ACNGT	2 cut(s)	11, 44
BstAFI	CTTAAG	1 cut(s)	146
BstC8I	GCNNGC	1 cut(s)	272
BstF5I	GGATG	1 cut(s)	129
BstKTI	GATC	1 cut(s)	115
BstMBI	GATC	1 cut(s)	112
BstMWI	GCNNNNNNNGC	1 cut(s)	184
BstSFI	CTRYAG	1 cut(s)	176
BstV1I	GCAGC	1 cut(s)	162
BstV2I	GAAGAC	1 cut(s)	158
BsuRI	GGCC	1 cut(s)	88
BtsCI	GGATG	1 cut(s)	129
Cac8I	GCNNGC	1 cut(s)	272
Cfr13I	GGNCC	1 cut(s)	79
CviAII	CATG	1 cut(s)	257
CviJI	RGCY	6 cut(s)	76, 88, 145, 175, 270, 274
CviKI_1	RGCY	6 cut(s)	76, 88, 145, 175, 270, 274
DpnI	GATC	1 cut(s)	114
DpnII	GATC	1 cut(s)	112
EaeI	YGGCCR	1 cut(s)	86
Eco47I	GGWCC	1 cut(s)	79
EcoRI	GAATTC	1 cut(s)	263
FaeI	CATG	1 cut(s)	260
FaiI	YATR	5 cut(s)	47, 49, 172, 226, 258
FatI	CATG	1 cut(s)	256
Fnu4HI	GCNGC	1 cut(s)	176
FokI	GGATG	1 cut(s)	116
Fsp4HI	GCNGC	1 cut(s)	176
FspBI	CTAG	1 cut(s)	107
GluI	GCNGC	1 cut(s)	176
HaeIII	GGCC	1 cut(s)	88
Hin1II	CATG	1 cut(s)	260
HincII	GTYRAC	1 cut(s)	204
HindII	GTYRAC	1 cut(s)	204
HindIII	AAGCTT	1 cut(s)	143
HinfI	GANTC	2 cut(s)	195, 246
HpaI	GTTAAC	1 cut(s)	204
Hpy166II	GTNNAC	1 cut(s)	204
Hpy8I	GTNNAC	1 cut(s)	204
HpyCH4III	ACNGT	2 cut(s)	11, 44
HpyCH4V	TGCA	1 cut(s)	178
HpyF10VI	GCNNNNNNNGC	1 cut(s)	184
Hsp92II	CATG	1 cut(s)	260
KspAI	GTTAAC	1 cut(s)	204
Kzo9I	GATC	1 cut(s)	112
LpnPI	CCDG	6 cut(s)	38, 49, 62, 95, 101, 164
Lsp1109I	GCAGC	1 cut(s)	162
LweI	GCATC	1 cut(s)	229
MaeI	CTAG	1 cut(s)	107
MaeIII	GTNAC	1 cut(s)	38
MalI	GATC	1 cut(s)	114
MboI	GATC	1 cut(s)	112
MboII	GAAGA	1 cut(s)	163
MlsI	TGGCCA	1 cut(s)	88
MluCI	AATT	2 cut(s)	211, 263
MluNI	TGGCCA	1 cut(s)	88
MlyI	GAGTC	1 cut(s)	189
MnlI	CCTC	1 cut(s)	253
Mox20I	TGGCCA	1 cut(s)	88
MscI	TGGCCA	1 cut(s)	88
MseI	TTAA	5 cut(s)	147, 203, 242, 251, 278
MslI	CAYNNNNRTG	1 cut(s)	134
Msp20I	TGGCCA	1 cut(s)	88
MspA1I	CMGCKG	1 cut(s)	274
MspCI	CTTAAG	1 cut(s)	146
MwoI	GCNNNNNNNGC	1 cut(s)	184
NdeII	GATC	1 cut(s)	112
NlaIII	CATG	1 cut(s)	260
PfeI	GAWTC	1 cut(s)	246
PkrI	GCNGC	1 cut(s)	177
PleI	GAGTC	1 cut(s)	189
PpsI	GAGTC	1 cut(s)	189
PspPI	GGNCC	1 cut(s)	79
PstI	CTGCAG	1 cut(s)	180
PvuII	CAGCTG	1 cut(s)	274
RseI	CAYNNNNRTG	1 cut(s)	134
SaqAI	TTAA	5 cut(s)	147, 203, 242, 251, 278
SatI	GCNGC	1 cut(s)	176
Sau3AI	GATC	1 cut(s)	112
Sau96I	GGNCC	1 cut(s)	79
SchI	GAGTC	1 cut(s)	189
SetI	ASST	3 cut(s)	120, 147, 276
SfaNI	GCATC	1 cut(s)	229
SfcI	CTRYAG	1 cut(s)	176
SinI	GGWCC	1 cut(s)	79
SmiMI	CAYNNNNRTG	1 cut(s)	134
SmlI	CTYRAG	1 cut(s)	146
SmoI	CTYRAG	1 cut(s)	146
Sse9I	AATT	2 cut(s)	211, 263
SspMI	CTAG	1 cut(s)	107
TaaI	ACNGT	2 cut(s)	11, 44
TasI	AATT	2 cut(s)	211, 263
TfiI	GAWTC	1 cut(s)	246
Tru1I	TTAA	5 cut(s)	147, 203, 242, 251, 278
Tru9I	TTAA	5 cut(s)	147, 203, 242, 251, 278
TseI	GCWGC	1 cut(s)	175
Vha464I	CTTAAG	1 cut(s)	146
VpaK11BI	GGWCC	1 cut(s)	79
XapI	RAATTY	2 cut(s)	211, 263
XspI	CTAG	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.