pycom02g20090

Belongs to the TBCA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0003164
Physical Location & Seq
Reverse (-)
18216503 .. 18217895
1393 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g20090.1

Sequence Viewer

Length: 234 bp
ATGAAAGAGAAAGGAGCTGATCCGTATGACCTGAAGCAGCAGGAAAATGTGCTTGCTGAATCAAGGATGATGATTCCTGACTGTCGGAAACGCTTGGAGGCCTCATTAGCTGACCTGAAAGGAATTTTGGCTGAAGTAGAAGAAGAGTTGAACCAGAAGGAAGGCCCTGAAATTGAAGAAGCTCGAACTGTTATTGGAGAAGTTGACACACTGTTCCAGACAACAGAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TBCA

Protein Analysis

78

Amino Acids

8.69

Weight (kDa)

4.41

Isoelectric Point (pI)

42.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 1 - 65 1.1e-16 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 14
AcsI RAATTY 1 cut(s) 123
AcuI CTGAAG 2 cut(s) 53, 153
AgsI TTSAA 2 cut(s) 151, 176
AjuI GAANNNNNNNTTGG 2 cut(s) 110, 142
AluBI AGCT 3 cut(s) 17, 110, 182
AluI AGCT 3 cut(s) 17, 110, 182
AlwI GGATC 1 cut(s) 14
AoxI GGCC 2 cut(s) 99, 163
ApeKI GCWGC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 123
AspS9I GGNCC 1 cut(s) 164
BbvI GCAGC 1 cut(s) 49
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 164
BseGI GGATG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 49
BshFI GGCC 2 cut(s) 101, 165
BsnI GGCC 2 cut(s) 101, 165
Bsp143I GATC 1 cut(s) 19
BspANI GGCC 2 cut(s) 101, 165
BspPI GGATC 1 cut(s) 14
BssMI GATC 1 cut(s) 19
Bst4CI ACNGT 3 cut(s) 83, 190, 213
Bst6I CTCTTC 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 54
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstV1I GCAGC 1 cut(s) 49
BsuRI GGCC 2 cut(s) 101, 165
BtsCI GGATG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 209
Cac8I GCNNGC 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 164
CviJI RGCY 7 cut(s) 17, 101, 110, 131, 165, 182, 230
CviKI_1 RGCY 7 cut(s) 17, 101, 110, 131, 165, 182, 230
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco147I AGGCCT 1 cut(s) 101
Eco57I CTGAAG 2 cut(s) 53, 153
EcoO109I RGGNCCY 1 cut(s) 164
FaiI YATR 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 38
FokI GGATG 1 cut(s) 79
Fsp4HI GCNGC 1 cut(s) 38
GluI GCNGC 1 cut(s) 38
HaeIII GGCC 2 cut(s) 101, 165
HincII GTYRAC 1 cut(s) 205
HindII GTYRAC 1 cut(s) 205
HinfI GANTC 2 cut(s) 59, 73
Hpy166II GTNNAC 1 cut(s) 205
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 2 cut(s) 77, 217
Hpy8I GTNNAC 1 cut(s) 205
HpyAV CCTTC 2 cut(s) 151, 155
HpyCH4III ACNGT 3 cut(s) 83, 190, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Kzo9I GATC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 7 cut(s) 26, 44, 90, 128, 167, 180, 230
Lsp1109I GCAGC 1 cut(s) 49
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 3 cut(s) 152, 155, 188
MluCI AATT 2 cut(s) 123, 171
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 2 cut(s) 91, 112
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 19
PceI AGGCCT 1 cut(s) 101
PfeI GAWTC 2 cut(s) 59, 73
PkrI GCNGC 1 cut(s) 39
PspPI GGNCC 1 cut(s) 164
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 1 cut(s) 19
Sau96I GGNCC 1 cut(s) 164
SetI ASST 5 cut(s) 19, 33, 112, 117, 184
Sse9I AATT 2 cut(s) 123, 171
SseBI AGGCCT 1 cut(s) 101
StuI AGGCCT 1 cut(s) 101
TaaI ACNGT 3 cut(s) 83, 190, 213
TaqI TCGA 1 cut(s) 184
TasI AATT 2 cut(s) 123, 171
TfiI GAWTC 2 cut(s) 59, 73
TscAI CASTG 1 cut(s) 216
TseI GCWGC 1 cut(s) 37
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 12
TspRI CASTG 1 cut(s) 216
XapI RAATTY 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.