RchiOBHm_Chr4g0446751

Belongs to the TBCA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0003164
Physical Location & Seq
Forward (+)
66810512 .. 66812315
1804 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41424

Sequence Viewer

Length: 162 bp
ATGGCAACTATAAGGAATTTGAAAATCAAGACTGGGACTTGTAAACGCCTCGTTAAGGAGTTTGATTCTTATGAGAAAGAGGTTGTGAGAGAGGCTGCGAAAAGAGCAGACATGAAGGGGAAAGGAGCTGATCCTTATGACCTCAAGAAATGTACTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TBCA

Protein Analysis

53

Amino Acids

5.99

Weight (kDa)

9.6

Isoelectric Point (pI)

20.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 3 - 50 2.2e-14 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 16
AfaI GTAC 1 cut(s) 154
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AlwI GGATC 1 cut(s) 125
ApeKI GCWGC 1 cut(s) 95
ApoI RAATTY 1 cut(s) 16
BbvI GCAGC 1 cut(s) 82
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BmrI ACTGGG 1 cut(s) 42
BmuI ACTGGG 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse1I ACTGG 2 cut(s) 37, 160
BseLI CCNNNNNNNGG 1 cut(s) 55
BseNI ACTGG 2 cut(s) 37, 160
BseXI GCAGC 1 cut(s) 82
BslFI GGGAC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 55
BsmFI GGGAC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 130
BspPI GGATC 1 cut(s) 125
BsrI ACTGG 2 cut(s) 37, 160
BssMI GATC 1 cut(s) 130
BstENI CCTNNNNNAGG 1 cut(s) 53
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstV1I GCAGC 1 cut(s) 82
Csp6I GTAC 1 cut(s) 153
CviAII CATG 1 cut(s) 112
CviJI RGCY 3 cut(s) 95, 128, 159
CviKI_1 RGCY 3 cut(s) 95, 128, 159
CviQI GTAC 1 cut(s) 153
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
EcoNI CCTNNNNNAGG 1 cut(s) 53
FaeI CATG 1 cut(s) 115
FaiI YATR 4 cut(s) 11, 72, 113, 138
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 111
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
GluI GCNGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 115
HinfI GANTC 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 28, 145
Hpy8I GTNNAC 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
Hsp92II CATG 1 cut(s) 115
Kzo9I GATC 1 cut(s) 130
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 2 cut(s) 18, 141
Lsp1109I GCAGC 1 cut(s) 82
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MluCI AATT 1 cut(s) 16
MnlI CCTC 4 cut(s) 59, 73, 85, 152
MseI TTAA 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 115
PfeI GAWTC 1 cut(s) 65
PkrI GCNGC 1 cut(s) 97
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 1 cut(s) 130
SetI ASST 3 cut(s) 84, 130, 144
SgeI CNNG 6 cut(s) 40, 45, 51, 62, 124, 157
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 1 cut(s) 16
TasI AATT 1 cut(s) 16
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseI GCWGC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 128
XagI CCTNNNNNAGG 1 cut(s) 53
XapI RAATTY 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.