RchiOBHm_Chr3g0457191

Belongs to the TBCA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0003164
Physical Location & Seq
Reverse (-)
6397652 .. 6398026
375 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42395

Sequence Viewer

Length: 294 bp
ATGATGATTCACTACAAATTTCTTCGTTGCAAACCGAAAGATGTAGTTTGGTTCGGAGTTTCATTCCTGAATGAGAATCTTTGCTATGCTCTTGGTGATGTGGCAACTGTAAGGAATCTGAAAATCAAGACTGGGACTTGTAAACGCCTCGTTAAGGAGTTTGATTCTTATGAGAAAGAGGTATTGAGAGAGGCTGTGAAAACAACAGACATGAAGGGGAAAGGAGCTGATCTTTATGACCTCAAGCAACAGGTATGGTTAACATTGTTATCATGCAACCGACGGCAATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TBCA

Protein Analysis

97

Amino Acids

11.4

Weight (kDa)

9.36

Isoelectric Point (pI)

35.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 36 - 85 3.9e-13 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 154
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
ApoI RAATTY 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 141
BmuI ACTGGG 1 cut(s) 141
BpuEI CTTGAG 1 cut(s) 227
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 154
BseNI ACTGG 1 cut(s) 136
BslFI GGGAC 1 cut(s) 148
BslI CCNNNNNNNGG 1 cut(s) 154
BsmFI GGGAC 1 cut(s) 148
Bsp143I GATC 1 cut(s) 229
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 229
Bst4CI ACNGT 1 cut(s) 109
BstENI CCTNNNNNAGG 1 cut(s) 152
BstKTI GATC 1 cut(s) 232
BstMBI GATC 1 cut(s) 229
CviAII CATG 2 cut(s) 211, 273
CviJI RGCY 2 cut(s) 194, 227
CviKI_1 RGCY 2 cut(s) 194, 227
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
EcoNI CCTNNNNNAGG 1 cut(s) 152
FaeI CATG 2 cut(s) 214, 276
FaiI YATR 6 cut(s) 87, 171, 212, 237, 256, 274
FaqI GGGAC 1 cut(s) 148
FatI CATG 2 cut(s) 210, 272
Hin1II CATG 2 cut(s) 214, 276
HincII GTYRAC 1 cut(s) 261
HindII GTYRAC 1 cut(s) 261
HinfI GANTC 4 cut(s) 7, 76, 115, 164
HpaI GTTAAC 1 cut(s) 261
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 2 cut(s) 143, 261
Hpy188I TCNGA 2 cut(s) 56, 120
Hpy188III TCNNGA 2 cut(s) 67, 127
Hpy8I GTNNAC 2 cut(s) 143, 261
Hpy99I CGWCG 1 cut(s) 285
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 30, 276
Hsp92II CATG 2 cut(s) 214, 276
KspAI GTTAAC 1 cut(s) 261
Kzo9I GATC 1 cut(s) 229
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 3 cut(s) 80, 117, 236
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MboII GAAGA 1 cut(s) 14
MluCI AATT 1 cut(s) 17
MnlI CCTC 4 cut(s) 158, 172, 184, 251
MseI TTAA 3 cut(s) 153, 260, 292
NdeII GATC 1 cut(s) 229
NlaIII CATG 2 cut(s) 214, 276
PfeI GAWTC 4 cut(s) 7, 76, 115, 164
SaqAI TTAA 3 cut(s) 153, 260, 292
Sau3AI GATC 1 cut(s) 229
SetI ASST 4 cut(s) 183, 229, 243, 255
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 1 cut(s) 17
SspI AATATT 1 cut(s) 290
TaaI ACNGT 1 cut(s) 109
TasI AATT 1 cut(s) 17
TfiI GAWTC 4 cut(s) 7, 76, 115, 164
Tru1I TTAA 3 cut(s) 153, 260, 292
Tru9I TTAA 3 cut(s) 153, 260, 292
TspDTI ATGAA 2 cut(s) 51, 227
XagI CCTNNNNNAGG 1 cut(s) 152
XapI RAATTY 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.