RchiOBHm_Chr1g0342531

Belongs to the TBCA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0003164
Physical Location & Seq
Forward (+)
34397412 .. 34400473
3062 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56915

Sequence Viewer

Length: 138 bp
ATGAAGGGGAAAGGAGCTGATCCTTATGACCTCAAGCAACAGGAAAATGTGCTGGTTGAATCAAGGATGATGATTCCCGATTGTCAAAAGCGCCTGGAGACCTCACTAGCTGCGTTAAAAGGAACTTTGATATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TBCA

Protein Analysis

45

Amino Acids

5.02

Weight (kDa)

7.77

Isoelectric Point (pI)

23.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 1 - 42 1.6e-12 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 14
AgsI TTSAA 1 cut(s) 59
AjnI CCWGG 1 cut(s) 93
AluBI AGCT 2 cut(s) 17, 110
AluI AGCT 2 cut(s) 17, 110
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 110
AspLEI GCGC 1 cut(s) 93
BbvI GCAGC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 107
BfoI RGCGCY 1 cut(s) 94
BisI GCNGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 112
Bme1390I CCNGG 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 95
BpmI CTGGAG 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 17
BsaI GGTCTC 1 cut(s) 92
BseBI CCWGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 92
Bso31I GGTCTC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 19
BspPI GGATC 1 cut(s) 14
BspTNI GGTCTC 1 cut(s) 92
BssMI GATC 1 cut(s) 19
Bst2UI CCWGG 1 cut(s) 95
BstF5I GGATG 1 cut(s) 72
BstH2I RGCGCY 1 cut(s) 94
BstHHI GCGC 1 cut(s) 93
BstKTI GATC 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 93
BstV1I GCAGC 1 cut(s) 97
BtsCI GGATG 1 cut(s) 72
CfoI GCGC 1 cut(s) 93
CviJI RGCY 2 cut(s) 17, 110
CviKI_1 RGCY 2 cut(s) 17, 110
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eco31I GGTCTC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 93
FaiI YATR 2 cut(s) 27, 133
Fnu4HI GCNGC 1 cut(s) 111
FokI GGATG 1 cut(s) 79
Fsp4HI GCNGC 1 cut(s) 111
FspBI CTAG 1 cut(s) 107
GlaI GCGC 1 cut(s) 92
GluI GCNGC 1 cut(s) 111
GsuI CTGGAG 1 cut(s) 116
HaeII RGCGCY 1 cut(s) 94
HhaI GCGC 1 cut(s) 93
Hin6I GCGC 1 cut(s) 91
HinP1I GCGC 1 cut(s) 91
HinfI GANTC 2 cut(s) 59, 73
Hpy188III TCNNGA 1 cut(s) 77
HspAI GCGC 1 cut(s) 91
Kzo9I GATC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 4 cut(s) 26, 38, 80, 107
Lsp1109I GCAGC 1 cut(s) 97
MaeI CTAG 1 cut(s) 107
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MnlI CCTC 2 cut(s) 41, 112
MseI TTAA 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
NdeII GATC 1 cut(s) 19
PfeI GAWTC 2 cut(s) 59, 73
PkrI GCNGC 1 cut(s) 112
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
SaqAI TTAA 1 cut(s) 116
SatI GCNGC 1 cut(s) 111
Sau3AI GATC 1 cut(s) 19
ScrFI CCNGG 1 cut(s) 95
SetI ASST 4 cut(s) 19, 33, 104, 112
SgeI CNNG 8 cut(s) 46, 53, 65, 75, 89, 106, 107, 119
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
SspMI CTAG 1 cut(s) 107
StyD4I CCNGG 1 cut(s) 93
TfiI GAWTC 2 cut(s) 59, 73
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TseI GCWGC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.