pycom07g15040

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
17110160 .. 17111283
1124 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g15040.1

Sequence Viewer

Length: 189 bp
ATGCTTCCAAGGCTGGAACAGTCATTGCCAGACAACAGCTGTGGGCTCTGCAGTTGGGATACTCATTTTGATAATCGTCTCTTTCTTCCAGCTGTAGTAAGGCCAATTCTTGATTCCTTTGAAGCTTCTAAGCAAGTCCCTCAGCCTGCTTTAAGCGATGTGGTTGCAGGTATGACAGGTAAAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.83

Weight (kDa)

5.55

Isoelectric Point (pI)

54.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 158
AgsI TTSAA 1 cut(s) 122
AjuI GAANNNNNNNTTGG 2 cut(s) 97, 129
AluBI AGCT 3 cut(s) 39, 92, 125
AluI AGCT 3 cut(s) 39, 92, 125
Alw26I GTCTC 1 cut(s) 83
AoxI GGCC 1 cut(s) 101
BanII GRGCYC 1 cut(s) 48
BbvCI CCTCAGC 1 cut(s) 141
BcgI CGANNNNNNTGC 2 cut(s) 146, 180
BciVI GTATCC 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 83
BfmI CTRYAG 2 cut(s) 49, 93
BfuAI ACCTGC 1 cut(s) 158
BfuI GTATCC 1 cut(s) 52
Bpu10I CCTNAGC 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 8
Bse3DI GCAATG 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 8
BseMI GCAATG 1 cut(s) 23
BseMII CTCAG 1 cut(s) 155
BshFI GGCC 1 cut(s) 103
BslFI GGGAC 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 83
BsmBI CGTCTC 1 cut(s) 83
BsmFI GGGAC 1 cut(s) 122
BsnI GGCC 1 cut(s) 103
Bsp1286I GDGCHC 1 cut(s) 48
BspANI GGCC 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 154
BspMAI CTGCAG 1 cut(s) 53
BspMI ACCTGC 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 8
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 129, 141
BstMAI GTCTC 1 cut(s) 83
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSFI CTRYAG 2 cut(s) 49, 93
BsuI GTATCC 1 cut(s) 52
BsuRI GGCC 1 cut(s) 103
BtgZI GCGATG 1 cut(s) 171
BveI ACCTGC 1 cut(s) 158
Cac8I GCNNGC 1 cut(s) 147
CspCI CAANNNNNGTGG 2 cut(s) 22, 57
CviJI RGCY 7 cut(s) 13, 39, 46, 92, 103, 125, 145
CviKI_1 RGCY 7 cut(s) 13, 39, 46, 92, 103, 125, 145
DdeI CTNAG 2 cut(s) 129, 141
Eco130I CCWWGG 1 cut(s) 8
Eco24I GRGCYC 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 8
EcoT38I GRGCYC 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 8
Esp3I CGTCTC 1 cut(s) 83
FaiI YATR 1 cut(s) 173
FaqI GGGAC 1 cut(s) 122
FriOI GRGCYC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 103
HindIII AAGCTT 1 cut(s) 123
HinfI GANTC 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4V TGCA 2 cut(s) 51, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 129, 141
LpnPI CCDG 5 cut(s) 42, 102, 153, 159, 162
MboII GAAGA 1 cut(s) 77
MhlI GDGCHC 1 cut(s) 48
MluCI AATT 1 cut(s) 105
MnlI CCTC 1 cut(s) 150
MseI TTAA 1 cut(s) 152
MspA1I CMGCKG 2 cut(s) 39, 92
MwoI GCNNNNNNNGC 1 cut(s) 10
PfeI GAWTC 1 cut(s) 113
PstI CTGCAG 1 cut(s) 53
PvuII CAGCTG 2 cut(s) 39, 92
SaqAI TTAA 1 cut(s) 152
SduI GDGCHC 1 cut(s) 48
SetI ASST 5 cut(s) 41, 94, 127, 172, 181
SfcI CTRYAG 2 cut(s) 49, 93
SgeI CNNG 8 cut(s) 21, 26, 41, 101, 122, 146, 158, 180
Sse9I AATT 1 cut(s) 105
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 21
TasI AATT 1 cut(s) 105
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.