pycom13g17800

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
13702389 .. 13702904
516 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 393 bp
ATGAAGCCTGTTCATATCATACACGACATGATCGAAAGGTTCCAGTCAAATAGAACAAATGATGTTGAGCCAAGAATCCACATCTATGAATTGAAAGGTCCAAATGATCAACTCTACAATCAGTTGTTAGAATCAATAGGTCTTCAAATTGTTCATTTGAAAAAATTGAAACCCTTCTTACTGGATGATCATGATACTTCCCAAAAATCAAAATTCTTGATCAATGGAGGAACAATATCATCATTTTTGTTCAATAAGATACCAAAGTGGATGATTGACTCATTCTATACTAGAAATAATCGTTTGATCGATCAAGACAATTGGTTGAATCTCGTGAAACCATTTCATAAAAGTTCATTGATATCTTCTTTTTATAAAGCAAATCGACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

15.41

Weight (kDa)

9.52

Isoelectric Point (pI)

43.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 25 - 130 5.5e-54 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 375
AcsI RAATTY 1 cut(s) 212
AgsI TTSAA 6 cut(s) 94, 146, 160, 169, 253, 328
ApoI RAATTY 1 cut(s) 212
Asp700I GAANNNNTTC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 98
AvaII GGWCC 1 cut(s) 98
BaeI ACNNNNGTAYC 2 cut(s) 251, 284
BauI CACGAG 1 cut(s) 332
BbsI GAAGAC 1 cut(s) 134
BclI TGATCA 3 cut(s) 106, 187, 219
BfaI CTAG 1 cut(s) 291
Bme18I GGWCC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 41
BpiI GAAGAC 1 cut(s) 134
Bsa29I ATCGAT 1 cut(s) 309
Bse1I ACTGG 2 cut(s) 43, 186
BseCI ATCGAT 1 cut(s) 309
BseGI GGATG 2 cut(s) 190, 276
BseNI ACTGG 2 cut(s) 43, 186
BshVI ATCGAT 1 cut(s) 309
Bsp143I GATC 6 cut(s) 30, 106, 187, 219, 306, 310
BspDI ATCGAT 1 cut(s) 309
BspHI TCATGA 1 cut(s) 190
BspLI GGNNCC 1 cut(s) 41
BsrI ACTGG 2 cut(s) 43, 186
BssMI GATC 6 cut(s) 30, 106, 187, 219, 306, 310
BssSI CACGAG 1 cut(s) 332
Bst2BI CACGAG 1 cut(s) 332
BstF5I GGATG 2 cut(s) 190, 276
BstKTI GATC 6 cut(s) 33, 109, 190, 222, 309, 313
BstMBI GATC 6 cut(s) 30, 106, 187, 219, 306, 310
BstV2I GAAGAC 1 cut(s) 134
Bsu15I ATCGAT 1 cut(s) 309
BsuTUI ATCGAT 1 cut(s) 309
BtsCI GGATG 2 cut(s) 190, 276
CciI TCATGA 1 cut(s) 190
Cfr13I GGNCC 1 cut(s) 98
ClaI ATCGAT 1 cut(s) 309
CviAII CATG 2 cut(s) 28, 191
CviJI RGCY 2 cut(s) 7, 70
CviKI_1 RGCY 2 cut(s) 7, 70
DpnI GATC 6 cut(s) 32, 108, 189, 221, 308, 312
DpnII GATC 6 cut(s) 30, 106, 187, 219, 306, 310
Eco32I GATATC 1 cut(s) 363
Eco47I GGWCC 1 cut(s) 98
EcoRV GATATC 1 cut(s) 363
FaeI CATG 2 cut(s) 31, 194
FaiI YATR 8 cut(s) 15, 20, 29, 87, 192, 288, 348, 375
FatI CATG 2 cut(s) 27, 190
FbaI TGATCA 3 cut(s) 106, 187, 219
FokI GGATG 2 cut(s) 197, 283
FspBI CTAG 1 cut(s) 291
Hin1II CATG 2 cut(s) 31, 194
HinfI GANTC 4 cut(s) 75, 131, 278, 328
Hpy188III TCNNGA 4 cut(s) 191, 217, 314, 334
HpyAV CCTTC 1 cut(s) 184
Hsp92II CATG 2 cut(s) 31, 194
Ksp22I TGATCA 3 cut(s) 106, 187, 219
Kzo9I GATC 6 cut(s) 30, 106, 187, 219, 306, 310
LpnPI CCDG 3 cut(s) 21, 56, 167
MaeI CTAG 1 cut(s) 291
MalI GATC 6 cut(s) 32, 108, 189, 221, 308, 312
MboI GATC 6 cut(s) 30, 106, 187, 219, 306, 310
MboII GAAGA 2 cut(s) 134, 357
MfeI CAATTG 1 cut(s) 319
MluCI AATT 5 cut(s) 89, 147, 164, 212, 319
MlyI GAGTC 1 cut(s) 272
MnlI CCTC 1 cut(s) 221
MroXI GAANNNNTTC 1 cut(s) 173
MslI CAYNNNNRTG 1 cut(s) 84
MunI CAATTG 1 cut(s) 319
NdeII GATC 6 cut(s) 30, 106, 187, 219, 306, 310
NlaIII CATG 2 cut(s) 31, 194
NlaIV GGNNCC 1 cut(s) 41
PagI TCATGA 1 cut(s) 190
PcsI WCGNNNNNNNCGW 1 cut(s) 30
PdmI GAANNNNTTC 1 cut(s) 173
PfeI GAWTC 3 cut(s) 75, 131, 328
PleI GAGTC 1 cut(s) 272
PpsI GAGTC 1 cut(s) 272
PsiI TTATAA 1 cut(s) 375
PspN4I GGNNCC 1 cut(s) 41
PspPI GGNCC 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 84
Sau3AI GATC 6 cut(s) 30, 106, 187, 219, 306, 310
Sau96I GGNCC 1 cut(s) 98
SchI GAGTC 1 cut(s) 272
SetI ASST 3 cut(s) 41, 100, 142
SinI GGWCC 1 cut(s) 98
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 5 cut(s) 89, 147, 164, 212, 319
SspMI CTAG 1 cut(s) 291
TaqI TCGA 3 cut(s) 33, 309, 385
TasI AATT 5 cut(s) 89, 147, 164, 212, 319
TfiI GAWTC 3 cut(s) 75, 131, 328
TspDTI ATGAA 5 cut(s) 17, 102, 143, 335, 345
VpaK11BI GGWCC 1 cut(s) 98
XapI RAATTY 1 cut(s) 212
XmnI GAANNNNTTC 1 cut(s) 173
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.