pycom16g09770

Ankyrin repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0002610
Physical Location & Seq
Reverse (-)
6618759 .. 6619240
482 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g09770.1

Sequence Viewer

Length: 249 bp
ATGGAACTGTTTGATACAATTCAAAATGGCAAAGAATTTGAAAAGTTATTACTTAAGAATGCTCTCTCGCTTGCTAGGAAAAGTGGGATTAAAAATGATGCAGAGAATGTGCTATTGTACGAGCTTGCAAGAAGCCTTGTTCTTGGTGGGAAGCACGTAAAGAAGCACACAAAACAAAATGCGATAGAGGATCGATCTCATCATCCGCATCGAAAAAAACCAAAAATGGTGGGGGATGATCTACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 Ank_3 Ank_4

Protein Analysis

83

Amino Acids

9.37

Weight (kDa)

9.65

Isoelectric Point (pI)

26.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 206
AclWI GGATC 1 cut(s) 198
AcsI RAATTY 1 cut(s) 35
AfaI GTAC 1 cut(s) 119
AflII CTTAAG 1 cut(s) 53
AgsI TTSAA 2 cut(s) 23, 41
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AlwI GGATC 1 cut(s) 198
ApoI RAATTY 1 cut(s) 35
BfaI CTAG 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 242
BfrI CTTAAG 1 cut(s) 53
BmsI GCATC 2 cut(s) 88, 217
Bsa29I ATCGAT 1 cut(s) 193
BsaAI YACGTR 1 cut(s) 157
BseCI ATCGAT 1 cut(s) 193
BseGI GGATG 2 cut(s) 202, 241
BshVI ATCGAT 1 cut(s) 193
BsmI GAATGC 1 cut(s) 64
Bsp143I GATC 3 cut(s) 190, 194, 238
BspACI CCGC 1 cut(s) 206
BspDI ATCGAT 1 cut(s) 193
BspPI GGATC 1 cut(s) 198
BspTI CTTAAG 1 cut(s) 53
BssMI GATC 3 cut(s) 190, 194, 238
Bst4CI ACNGT 2 cut(s) 9, 246
BstAFI CTTAAG 1 cut(s) 53
BstBAI YACGTR 1 cut(s) 157
BstC8I GCNNGC 2 cut(s) 72, 126
BstF5I GGATG 2 cut(s) 202, 241
BstKTI GATC 3 cut(s) 193, 197, 241
BstMBI GATC 3 cut(s) 190, 194, 238
BstSFI CTRYAG 1 cut(s) 242
Bsu15I ATCGAT 1 cut(s) 193
BsuTUI ATCGAT 1 cut(s) 193
BtsCI GGATG 2 cut(s) 202, 241
Cac8I GCNNGC 2 cut(s) 72, 126
ClaI ATCGAT 1 cut(s) 193
Csp6I GTAC 1 cut(s) 118
CspCI CAANNNNNGTGG 2 cut(s) 210, 245
CviJI RGCY 2 cut(s) 124, 135
CviKI_1 RGCY 2 cut(s) 124, 135
CviQI GTAC 1 cut(s) 118
DpnI GATC 3 cut(s) 192, 196, 240
DpnII GATC 3 cut(s) 190, 194, 238
FokI GGATG 1 cut(s) 189
FspBI CTAG 1 cut(s) 75
HpyCH4III ACNGT 2 cut(s) 9, 246
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 101, 128
HpySE526I ACGT 1 cut(s) 156
Kzo9I GATC 3 cut(s) 190, 194, 238
LweI GCATC 2 cut(s) 88, 217
MaeI CTAG 1 cut(s) 75
MaeII ACGT 1 cut(s) 156
MalI GATC 3 cut(s) 192, 196, 240
MboI GATC 3 cut(s) 190, 194, 238
MluCI AATT 2 cut(s) 18, 35
MnlI CCTC 1 cut(s) 181
MseI TTAA 2 cut(s) 54, 90
MspCI CTTAAG 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 64
NdeII GATC 3 cut(s) 190, 194, 238
PctI GAATGC 1 cut(s) 64
Ppu21I YACGTR 1 cut(s) 157
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 54, 90
Sau3AI GATC 3 cut(s) 190, 194, 238
SetI ASST 2 cut(s) 126, 159
SfaNI GCATC 2 cut(s) 88, 217
SfcI CTRYAG 1 cut(s) 242
SgeI CNNG 9 cut(s) 79, 83, 87, 133, 137, 141, 149, 155, 167
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 2 cut(s) 18, 35
SsiI CCGC 1 cut(s) 206
SspMI CTAG 1 cut(s) 75
TaaI ACNGT 2 cut(s) 9, 246
TaiI ACGT 1 cut(s) 159
TaqI TCGA 2 cut(s) 193, 211
TasI AATT 2 cut(s) 18, 35
Tru1I TTAA 2 cut(s) 54, 90
Tru9I TTAA 2 cut(s) 54, 90
Vha464I CTTAAG 1 cut(s) 53
XapI RAATTY 1 cut(s) 35
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.