pycom16g22830

tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
23196120 .. 23198695
2576 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g22830.1

Sequence Viewer

Length: 816 bp
ATGCAATCGCCGGCGACACGGTCAATATCCCTAAAACCTTCTTCACCGACAGAGATGCTGATAAAGGAAGAAGAAGGAGAGAATGAATGCCATAGCGATATGAATCCCCCAAATCCCTCCTCCTCCTCTTCCACCGCCACCAACAGAGATGCCTCCGATGGCTTTGAAACTGCTAGCGAAGGCGAACTCAACGACGACGAAATCCCTCAACAACTCCATCTCCAAGACGAACAACAAGAAACTCCCTCTCCGAACGATGACGACGTTGAATCGAAGCAGAAAGCGTTTGAAGAAGCAAGTGATGTGAAAATTGAAGGAAATAGACTTTTTGGCAGTGGGCAATACCAGGAGGCACTAACACAGTATGAGCTTGCTTTACACCTTGCACCTGATATGCCACTGTCTGTCGAATTACGTTCCATTTGTCATTTAAACAGTGCAGTATGCTTCTCGAAATTGGAAAAGTATGAGGACGCAATCAAGGAATGCACAAAAGCGCTTGAACTCAATCCTTCATATATGAAAGCTCTGCTTAGAAGAGCAGAAACTCATGAAAAGCTCGAGCATTTTGAAGAGGCTATTGTTGATATGAAAAGTGTCTTGGAACTGGATCCTTCAAATGACCAAGCCAAAATGGCCATTCGCCGTTTGGGGCCACTAGCTGAAGAAAAGAGAGAAAAGATGAAAGAGGAGATGATAGGGAAGCTGAAAGAAATGGGCAACTCGCTTTTGGGCCGTTTTGGAATGAGCGTCGACAACTTTAAAGCAGTCAAAGATCCAAACACTGGCTCATATTCTCTTTCATTCCAAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

272

Amino Acids

30.26

Weight (kDa)

4.68

Isoelectric Point (pI)

58.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_1 PF00515 142 - 173 3.3e-07 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 785
AccI GTMKAC 1 cut(s) 753
AciI CCGC 1 cut(s) 135
AclWI GGATC 3 cut(s) 605, 618, 770
AcoI YGGCCR 1 cut(s) 636
AcuI CTGAAG 1 cut(s) 684
AfeI AGCGCT 1 cut(s) 498
AfiI CCNNNNNNNGG 1 cut(s) 785
AgsI TTSAA 7 cut(s) 167, 269, 290, 314, 503, 572, 618
AjnI CCWGG 1 cut(s) 345
AjuI GAANNNNNNNTTGG 2 cut(s) 584, 616
AluBI AGCT 5 cut(s) 370, 527, 559, 662, 706
AluI AGCT 5 cut(s) 370, 527, 559, 662, 706
AlwI GGATC 3 cut(s) 605, 618, 770
Ama87I CYCGRG 1 cut(s) 560
Aor51HI AGCGCT 1 cut(s) 498
AoxI GGCC 3 cut(s) 636, 653, 733
AspLEI GCGC 1 cut(s) 499
AspS9I GGNCC 2 cut(s) 653, 733
AsuHPI GGTGA 1 cut(s) 36
AsuNHI GCTAGC 1 cut(s) 173
AvaI CYCGRG 1 cut(s) 560
BalI TGGCCA 1 cut(s) 638
BamHI GGATCC 1 cut(s) 610
BccI CCATC 2 cut(s) 152, 225
BceAI ACGGC 2 cut(s) 630, 720
BcgI CGANNNNNNTGC 2 cut(s) 37, 71
BciT130I CCWGG 1 cut(s) 347
BfaI CTAG 3 cut(s) 174, 659, 814
BfoI RGCGCY 1 cut(s) 500
BglI GCCNNNNNGGC 1 cut(s) 635
Bme1390I CCNGG 1 cut(s) 347
BmeT110I CYCGRG 1 cut(s) 560
BmgT120I GGNCC 2 cut(s) 653, 733
BmiI GGNNCC 2 cut(s) 612, 654
BmrFI CCNGG 1 cut(s) 347
BmsI GCATC 2 cut(s) 45, 139
BmtI GCTAGC 1 cut(s) 177
BsaBI GATNNNNATC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 808
BsaXI ACNNNNNCTCC 4 cut(s) 204, 232, 234, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 785
Bse118I RCCGGY 1 cut(s) 10
Bse1I ACTGG 2 cut(s) 612, 790
Bse8I GATNNNNATC 1 cut(s) 102
BseBI CCWGG 1 cut(s) 347
BseDI CCNNGG 1 cut(s) 808
BseJI GATNNNNATC 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 785
BseNI ACTGG 2 cut(s) 612, 790
BseRI GAGGAG 4 cut(s) 109, 112, 115, 704
BsgI GTGCAG 1 cut(s) 459
BshFI GGCC 3 cut(s) 638, 655, 735
BsiHKCI CYCGRG 1 cut(s) 560
BsiSI CCGG 1 cut(s) 11
BslI CCNNNNNNNGG 1 cut(s) 785
BsmI GAATGC 2 cut(s) 92, 491
BsnI GGCC 3 cut(s) 638, 655, 735
BsoBI CYCGRG 1 cut(s) 560
Bsp143I GATC 2 cut(s) 610, 775
BspACI CCGC 1 cut(s) 135
BspANI GGCC 3 cut(s) 638, 655, 735
BspHI TCATGA 1 cut(s) 550
BspLI GGNNCC 2 cut(s) 612, 654
BspOI GCTAGC 1 cut(s) 177
BspPI GGATC 3 cut(s) 605, 618, 770
BspQI GCTCTTC 1 cut(s) 532
BsrFI RCCGGY 1 cut(s) 10
BsrI ACTGG 2 cut(s) 612, 790
BssAI RCCGGY 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 808
BssMI GATC 2 cut(s) 610, 775
BssT1I CCWWGG 1 cut(s) 808
Bst2UI CCWGG 1 cut(s) 347
Bst4CI ACNGT 4 cut(s) 21, 363, 402, 437
Bst6I CTCTTC 3 cut(s) 133, 532, 567
BstC8I GCNNGC 3 cut(s) 12, 175, 372
BstDEI CTNAG 1 cut(s) 533
BstH2I RGCGCY 1 cut(s) 500
BstHHI GCGC 1 cut(s) 499
BstKTI GATC 2 cut(s) 613, 778
BstMBI GATC 2 cut(s) 610, 775
BstMWI GCNNNNNNNGC 1 cut(s) 635
BstNI CCWGG 1 cut(s) 347
BstSCI CCNGG 1 cut(s) 345
BstX2I RGATCY 2 cut(s) 610, 775
BstYI RGATCY 2 cut(s) 610, 775
BsuRI GGCC 3 cut(s) 638, 655, 735
BtsI GCAGTG 1 cut(s) 340
BtsIMutI CAGTG 4 cut(s) 340, 398, 442, 783
Cac8I GCNNGC 3 cut(s) 12, 175, 372
CciI TCATGA 1 cut(s) 550
CfoI GCGC 1 cut(s) 499
Cfr10I RCCGGY 1 cut(s) 10
Cfr13I GGNCC 2 cut(s) 653, 733
CseI GACGC 2 cut(s) 482, 739
CviAII CATG 1 cut(s) 551
DdeI CTNAG 1 cut(s) 533
DpnI GATC 2 cut(s) 612, 777
DpnII GATC 2 cut(s) 610, 775
DraI TTTAAA 2 cut(s) 432, 763
EaeI YGGCCR 1 cut(s) 636
Eam1104I CTCTTC 3 cut(s) 133, 532, 567
EarI CTCTTC 3 cut(s) 133, 532, 567
Eco130I CCWWGG 1 cut(s) 808
Eco47III AGCGCT 1 cut(s) 498
Eco57I CTGAAG 1 cut(s) 684
Eco88I CYCGRG 1 cut(s) 560
EcoRII CCWGG 1 cut(s) 345
EcoT14I CCWWGG 1 cut(s) 808
ErhI CCWWGG 1 cut(s) 808
FaeI CATG 1 cut(s) 554
FalI AAGNNNNNCTT 2 cut(s) 516, 548
FatI CATG 1 cut(s) 550
FblI GTMKAC 1 cut(s) 753
FspBI CTAG 3 cut(s) 174, 659, 814
GlaI GCGC 1 cut(s) 498
HaeII RGCGCY 1 cut(s) 500
HaeIII GGCC 3 cut(s) 638, 655, 735
HapII CCGG 1 cut(s) 11
HgaI GACGC 2 cut(s) 482, 739
HhaI GCGC 1 cut(s) 499
Hin1II CATG 1 cut(s) 554
Hin6I GCGC 1 cut(s) 497
HinP1I GCGC 1 cut(s) 497
HincII GTYRAC 1 cut(s) 754
HindII GTYRAC 1 cut(s) 754
HinfI GANTC 2 cut(s) 103, 269
HpaII CCGG 1 cut(s) 11
HphI GGTGA 1 cut(s) 36
Hpy166II GTNNAC 1 cut(s) 754
Hpy188I TCNGA 2 cut(s) 157, 252
Hpy188III TCNNGA 2 cut(s) 451, 551
Hpy8I GTNNAC 1 cut(s) 754
Hpy99I CGWCG 4 cut(s) 197, 200, 266, 755
HpyAV CCTTC 6 cut(s) 48, 68, 173, 308, 522, 624
HpyCH4III ACNGT 4 cut(s) 21, 363, 402, 437
HpyCH4IV ACGT 2 cut(s) 264, 415
HpyCH4V TGCA 4 cut(s) 4, 386, 440, 489
HpyF10VI GCNNNNNNNGC 1 cut(s) 635
HpyF3I CTNAG 1 cut(s) 533
HpySE526I ACGT 2 cut(s) 264, 415
Hsp92II CATG 1 cut(s) 554
HspAI GCGC 1 cut(s) 497
KroI GCCGGC 1 cut(s) 10
KroNI GCCGGC 1 cut(s) 12
Kzo9I GATC 2 cut(s) 610, 775
LguI GCTCTTC 1 cut(s) 532
LpnPI CCDG 6 cut(s) 24, 332, 359, 402, 593, 771
LweI GCATC 2 cut(s) 45, 139
MaeI CTAG 3 cut(s) 174, 659, 814
MaeII ACGT 2 cut(s) 264, 415
MalI GATC 2 cut(s) 612, 777
MboI GATC 2 cut(s) 610, 775
MboII GAAGA 8 cut(s) 33, 80, 83, 120, 302, 549, 584, 677
MflI RGATCY 2 cut(s) 610, 775
MlsI TGGCCA 1 cut(s) 638
MluCI AATT 3 cut(s) 309, 410, 455
MluNI TGGCCA 1 cut(s) 638
Mox20I TGGCCA 1 cut(s) 638
MreI CGCCGGCG 1 cut(s) 10
MroNI GCCGGC 1 cut(s) 10
MscI TGGCCA 1 cut(s) 638
MseI TTAA 2 cut(s) 431, 762
Msp20I TGGCCA 1 cut(s) 638
MspI CCGG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 347
Mva1269I GAATGC 2 cut(s) 92, 491
MvaI CCWGG 1 cut(s) 347
MwoI GCNNNNNNNGC 1 cut(s) 635
NaeI GCCGGC 1 cut(s) 12
NdeII GATC 2 cut(s) 610, 775
NgoMIV GCCGGC 1 cut(s) 10
NheI GCTAGC 1 cut(s) 173
NlaIII CATG 1 cut(s) 554
NlaIV GGNNCC 2 cut(s) 612, 654
PaeR7I CTCGAG 1 cut(s) 560
PagI TCATGA 1 cut(s) 550
PciSI GCTCTTC 1 cut(s) 532
PcsI WCGNNNNNNNCGW 1 cut(s) 261
PctI GAATGC 2 cut(s) 92, 491
PdiI GCCGGC 1 cut(s) 12
PfeI GAWTC 2 cut(s) 103, 269
PflFI GACNNNGTC 1 cut(s) 19
PflMI CCANNNNNTGG 1 cut(s) 785
Psp6I CCWGG 1 cut(s) 345
PspGI CCWGG 1 cut(s) 345
PspN4I GGNNCC 2 cut(s) 612, 654
PspPI GGNCC 2 cut(s) 653, 733
PspXI VCTCGAGB 1 cut(s) 560
PsuI RGATCY 2 cut(s) 610, 775
PsyI GACNNNGTC 1 cut(s) 19
SalI GTCGAC 1 cut(s) 752
SapI GCTCTTC 1 cut(s) 532
SaqAI TTAA 2 cut(s) 431, 762
Sau3AI GATC 2 cut(s) 610, 775
Sau96I GGNCC 2 cut(s) 653, 733
ScrFI CCNGG 1 cut(s) 347
SfaNI GCATC 2 cut(s) 45, 139
Sfr274I CTCGAG 1 cut(s) 560
SgrAI CRCCGGYG 1 cut(s) 10
SlaI CTCGAG 1 cut(s) 560
SmlI CTYRAG 1 cut(s) 560
SmoI CTYRAG 1 cut(s) 560
Sse9I AATT 3 cut(s) 309, 410, 455
SsiI CCGC 1 cut(s) 135
SspMI CTAG 3 cut(s) 174, 659, 814
StyD4I CCNGG 1 cut(s) 345
StyI CCWWGG 1 cut(s) 808
TaaI ACNGT 4 cut(s) 21, 363, 402, 437
TaiI ACGT 2 cut(s) 267, 418
TaqI TCGA 5 cut(s) 272, 408, 452, 561, 753
TasI AATT 3 cut(s) 309, 410, 455
TfiI GAWTC 2 cut(s) 103, 269
Tru1I TTAA 2 cut(s) 431, 762
Tru9I TTAA 2 cut(s) 431, 762
TscAI CASTG 4 cut(s) 340, 405, 442, 790
TspDTI ATGAA 8 cut(s) 99, 116, 504, 536, 567, 605, 698, 792
TspRI CASTG 4 cut(s) 340, 405, 442, 790
Tth111I GACNNNGTC 1 cut(s) 19
Van91I CCANNNNNTGG 1 cut(s) 785
XcmI CCANNNNNNNNNTGG 1 cut(s) 646
XhoI CTCGAG 1 cut(s) 560
XmiI GTMKAC 1 cut(s) 753
XspI CTAG 3 cut(s) 174, 659, 814
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.