RLG00000008866

tetratricopeptide repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0003372
Physical Location & Seq
Reverse (-)
41422374 .. 41425240
2867 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008866

Sequence Viewer

Length: 726 bp
ATGCTTATAGAAGAAGAAGAAGAAGAGCGCAATGTGAAGACCCCAAAACCCTCGTCGTCCTCCGCCAACAAAGACCCCTCCGATGGCTTCGAAACTGCCAGCGACGGCGAGTTGGGACCCAACGAAAGCGACGATGAAACTCAACACCACGTCCAACTTGAAGAGACGGATGACCTTGCATTCAAACAGAAATCGCTTGAGCAAGCAAATGAGGTAAAATTGGAAGGCAATGGACTGTTTGGGAATGGACAATATGAAGAGGCATTGTCGCAGTATGAACTTGCTTTACAGCTTGCGCCGGACATGCCTTCATCTGTGGAATTACGTTCCATATGTCATTCGAACCGTGCCATATGCTTTTCGAAGCTGGGAAAATACGAAGACGCGGTTAAGGAATTCACAAAAGCACTGGAACTAAATCCTTCATATATGAAAGCGCTGATTAGAAGAGCAGAAGCTCATGAAAAACTAGAACATTTCGAAGAGGCTATTGCTGATATGAAAAAAATCTTAGAACTTGATCCTTCAAATGACCAAGCCAGGAAGGCCATTCGGCGCTTGGAGCCACTTGCTGAAGCAAAGAGAGAAAAGATGAAAGAGGAGATGATTGGGAAGTTGAAAGATATGGGCAACTCGTTGTTGGGCCGGTTTGGAATGAGCGTTGACAACTTCAAAGCTGTAAAAGATCCAAACACTGGCTCGTATTCTGTTTCATTCCAACGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TPR_1 TPR_2 TPR_8

Protein Analysis

242

Amino Acids

27.13

Weight (kDa)

4.91

Isoelectric Point (pI)

44.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_12 PF13424 78 - 139 4.9e-07 Tetratricopeptide repeat
TPR_2 PF07719 112 - 142 4.1e-07 Tetratricopeptide repeat
TPR_1 PF00515 112 - 143 3.9e-09 Tetratricopeptide repeat
TPR_11 PF13414 122 - 157 7.5e-06 TPR repeat
TPR_16 PF13432 122 - 177 4.6e-08 Tetratricopeptide repeat
TPR_19 PF14559 124 - 186 4.5e-07 Tetratricopeptide repeat
TPR_2 PF07719 145 - 177 2.3e-06 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 695
AccII CGCG 1 cut(s) 386
AciI CCGC 2 cut(s) 63, 386
AclI AACGTT 1 cut(s) 721
AclWI GGATC 2 cut(s) 515, 680
AcsI RAATTY 1 cut(s) 395
AcuI CTGAAG 1 cut(s) 594
AfeI AGCGCT 1 cut(s) 438
AfiI CCNNNNNNNGG 2 cut(s) 83, 695
AgsI TTSAA 5 cut(s) 161, 184, 528, 619, 673
AjiI CACGTC 1 cut(s) 151
AjnI CCWGG 1 cut(s) 539
AluBI AGCT 4 cut(s) 292, 367, 458, 677
AluI AGCT 4 cut(s) 292, 367, 458, 677
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 2 cut(s) 515, 680
Aor51HI AGCGCT 1 cut(s) 438
AoxI GGCC 2 cut(s) 546, 643
ApoI RAATTY 1 cut(s) 395
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
AspLEI GCGC 4 cut(s) 30, 298, 439, 558
AspS9I GGNCC 2 cut(s) 116, 643
AsuII TTCGAA 4 cut(s) 90, 341, 362, 480
AvaII GGWCC 1 cut(s) 116
BbsI GAAGAC 2 cut(s) 44, 387
BccI CCATC 1 cut(s) 77
BceAI ACGGC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 541
BcoDI GTCTC 1 cut(s) 158
BfaI CTAG 1 cut(s) 470
BfoI RGCGCY 2 cut(s) 440, 559
BglI GCCNNNNNGGC 1 cut(s) 545
Bme1390I CCNGG 1 cut(s) 541
Bme18I GGWCC 1 cut(s) 116
BmgBI CACGTC 1 cut(s) 151
BmgT120I GGNCC 2 cut(s) 116, 643
BmiI GGNNCC 3 cut(s) 117, 118, 564
BmrFI CCNGG 1 cut(s) 541
BpiI GAAGAC 2 cut(s) 44, 387
Bpu14I TTCGAA 4 cut(s) 90, 341, 362, 480
BpuEI CTTGAG 1 cut(s) 218
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 695
Bse118I RCCGGY 1 cut(s) 645
Bse1I ACTGG 2 cut(s) 414, 700
Bse3DI GCAATG 2 cut(s) 37, 235
BseBI CCWGG 1 cut(s) 541
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 2 cut(s) 83, 695
BseMI GCAATG 2 cut(s) 37, 235
BseNI ACTGG 2 cut(s) 414, 700
BseRI GAGGAG 1 cut(s) 614
BseYI CCCAGC 1 cut(s) 367
Bsh1236I CGCG 1 cut(s) 386
BshFI GGCC 2 cut(s) 548, 645
BsiSI CCGG 2 cut(s) 299, 646
BslFI GGGAC 1 cut(s) 129
BslI CCNNNNNNNGG 2 cut(s) 83, 695
BsmAI GTCTC 1 cut(s) 158
BsmBI CGTCTC 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 129
BsmI GAATGC 1 cut(s) 179
BsnI GGCC 2 cut(s) 548, 645
Bsp119I TTCGAA 4 cut(s) 90, 341, 362, 480
Bsp143I GATC 2 cut(s) 520, 685
BspACI CCGC 2 cut(s) 63, 386
BspANI GGCC 2 cut(s) 548, 645
BspFNI CGCG 1 cut(s) 386
BspHI TCATGA 1 cut(s) 460
BspLI GGNNCC 3 cut(s) 117, 118, 564
BspPI GGATC 2 cut(s) 515, 680
BspQI GCTCTTC 2 cut(s) 18, 442
BspT104I TTCGAA 4 cut(s) 90, 341, 362, 480
BsrDI GCAATG 2 cut(s) 37, 235
BsrFI RCCGGY 1 cut(s) 645
BsrI ACTGG 2 cut(s) 414, 700
BssAI RCCGGY 1 cut(s) 645
BssMI GATC 2 cut(s) 520, 685
Bst2UI CCWGG 1 cut(s) 541
Bst4CI ACNGT 2 cut(s) 237, 347
Bst6I CTCTTC 5 cut(s) 18, 156, 252, 442, 477
BstBI TTCGAA 4 cut(s) 90, 341, 362, 480
BstC8I GCNNGC 3 cut(s) 100, 204, 294
BstDEI CTNAG 1 cut(s) 511
BstF5I GGATG 1 cut(s) 175
BstFNI CGCG 1 cut(s) 386
BstH2I RGCGCY 2 cut(s) 440, 559
BstHHI GCGC 4 cut(s) 30, 298, 439, 558
BstKTI GATC 2 cut(s) 523, 688
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 2 cut(s) 520, 685
BstMWI GCNNNNNNNGC 3 cut(s) 304, 545, 562
BstNI CCWGG 1 cut(s) 541
BstNSI RCATGY 1 cut(s) 307
BstSCI CCNGG 1 cut(s) 539
BstUI CGCG 1 cut(s) 386
BstV2I GAAGAC 2 cut(s) 44, 387
BstX2I RGATCY 1 cut(s) 685
BstYI RGATCY 1 cut(s) 685
BsuRI GGCC 2 cut(s) 548, 645
BtrI CACGTC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 175
BtsIMutI CAGTG 2 cut(s) 407, 693
Cac8I GCNNGC 3 cut(s) 100, 204, 294
CciI TCATGA 1 cut(s) 460
CfoI GCGC 4 cut(s) 30, 298, 439, 558
Cfr10I RCCGGY 1 cut(s) 645
Cfr13I GGNCC 2 cut(s) 116, 643
CseI GACGC 1 cut(s) 392
CviAII CATG 2 cut(s) 304, 461
DdeI CTNAG 1 cut(s) 511
DpnI GATC 2 cut(s) 522, 687
DpnII GATC 2 cut(s) 520, 685
Eam1104I CTCTTC 5 cut(s) 18, 156, 252, 442, 477
EarI CTCTTC 5 cut(s) 18, 156, 252, 442, 477
EciI GGCGGA 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 116
Eco47III AGCGCT 1 cut(s) 438
Eco57I CTGAAG 1 cut(s) 594
EcoO109I RGGNCCY 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 395
EcoRII CCWGG 1 cut(s) 539
Esp3I CGTCTC 1 cut(s) 158
FaeI CATG 2 cut(s) 307, 464
FaqI GGGAC 1 cut(s) 129
FatI CATG 2 cut(s) 303, 460
FauNDI CATATG 2 cut(s) 332, 353
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 470
GlaI GCGC 4 cut(s) 29, 297, 438, 557
GsaI CCCAGC 1 cut(s) 371
HaeII RGCGCY 2 cut(s) 440, 559
HaeIII GGCC 2 cut(s) 548, 645
HapII CCGG 2 cut(s) 299, 646
HgaI GACGC 1 cut(s) 392
HhaI GCGC 4 cut(s) 30, 298, 439, 558
Hin1II CATG 2 cut(s) 307, 464
Hin6I GCGC 4 cut(s) 28, 296, 437, 556
HinP1I GCGC 4 cut(s) 28, 296, 437, 556
HincII GTYRAC 1 cut(s) 664
HindII GTYRAC 1 cut(s) 664
HpaII CCGG 2 cut(s) 299, 646
Hpy166II GTNNAC 1 cut(s) 664
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 461
Hpy8I GTNNAC 1 cut(s) 664
Hpy99I CGWCG 3 cut(s) 58, 107, 134
HpyAV CCTTC 5 cut(s) 218, 318, 432, 534, 538
HpyCH4III ACNGT 2 cut(s) 237, 347
HpyCH4IV ACGT 3 cut(s) 150, 325, 721
HpyCH4V TGCA 1 cut(s) 179
HpyF10VI GCNNNNNNNGC 3 cut(s) 304, 545, 562
HpyF3I CTNAG 1 cut(s) 511
HpySE526I ACGT 3 cut(s) 150, 325, 721
Hsp92II CATG 2 cut(s) 307, 464
HspAI GCGC 4 cut(s) 28, 296, 437, 556
KflI GGGWCCC 1 cut(s) 116
Kzo9I GATC 2 cut(s) 520, 685
LguI GCTCTTC 2 cut(s) 18, 442
LmnI GCTCC 1 cut(s) 562
LpnPI CCDG 8 cut(s) 112, 312, 353, 395, 526, 553, 659, 681
MaeI CTAG 1 cut(s) 470
MaeII ACGT 3 cut(s) 150, 325, 721
MalI GATC 2 cut(s) 522, 687
MboI GATC 2 cut(s) 520, 685
MflI RGATCY 1 cut(s) 685
MluCI AATT 3 cut(s) 218, 320, 395
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 7 cut(s) 61, 70, 88, 205, 253, 478, 592
MseI TTAA 1 cut(s) 390
MspI CCGG 2 cut(s) 299, 646
MspR9I CCNGG 1 cut(s) 541
Mva1269I GAATGC 1 cut(s) 179
MvaI CCWGG 1 cut(s) 541
MvnI CGCG 1 cut(s) 386
MwoI GCNNNNNNNGC 3 cut(s) 304, 545, 562
NdeI CATATG 2 cut(s) 332, 353
NdeII GATC 2 cut(s) 520, 685
NlaIII CATG 2 cut(s) 307, 464
NlaIV GGNNCC 3 cut(s) 117, 118, 564
NspI RCATGY 1 cut(s) 307
NspV TTCGAA 4 cut(s) 90, 341, 362, 480
PagI TCATGA 1 cut(s) 460
PciSI GCTCTTC 2 cut(s) 18, 442
PcsI WCGNNNNNNNCGW 1 cut(s) 129
PctI GAATGC 1 cut(s) 179
PflMI CCANNNNNTGG 1 cut(s) 695
PpuMI RGGWCCY 1 cut(s) 116
Psp1406I AACGTT 1 cut(s) 721
Psp5II RGGWCCY 1 cut(s) 116
Psp6I CCWGG 1 cut(s) 539
PspFI CCCAGC 1 cut(s) 367
PspGI CCWGG 1 cut(s) 539
PspN4I GGNNCC 3 cut(s) 117, 118, 564
PspPI GGNCC 2 cut(s) 116, 643
PspPPI RGGWCCY 1 cut(s) 116
PsrI GAACNNNNNNTAC 2 cut(s) 270, 302
PsuI RGATCY 1 cut(s) 685
SapI GCTCTTC 2 cut(s) 18, 442
SaqAI TTAA 1 cut(s) 390
Sau3AI GATC 2 cut(s) 520, 685
Sau96I GGNCC 2 cut(s) 116, 643
ScrFI CCNGG 1 cut(s) 541
SetI ASST 9 cut(s) 153, 177, 216, 294, 328, 369, 460, 679, 724
SfuI TTCGAA 4 cut(s) 90, 341, 362, 480
SinI GGWCC 1 cut(s) 116
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
Sse9I AATT 3 cut(s) 218, 320, 395
SsiI CCGC 2 cut(s) 63, 386
SspMI CTAG 1 cut(s) 470
StyD4I CCNGG 1 cut(s) 539
TaaI ACNGT 2 cut(s) 237, 347
TaiI ACGT 3 cut(s) 153, 328, 724
TaqI TCGA 4 cut(s) 90, 341, 362, 480
TasI AATT 3 cut(s) 218, 320, 395
Tru1I TTAA 1 cut(s) 390
Tru9I TTAA 1 cut(s) 390
TscAI CASTG 2 cut(s) 414, 700
TspGWI ACGGA 1 cut(s) 182
TspRI CASTG 2 cut(s) 414, 700
Van91I CCANNNNNTGG 1 cut(s) 695
VpaK11BI GGWCC 1 cut(s) 116
XapI RAATTY 1 cut(s) 395
XceI RCATGY 1 cut(s) 307
XcmI CCANNNNNNNNNTGG 1 cut(s) 556
XspI CTAG 1 cut(s) 470
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.