RchiOBHm_Chr5g0013401

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
9052768 .. 9054886
2119 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 147 bp
ATGTATGTTGGGGTAACCATAAGGAGATACAGAGCTATTCAGGACGTTGGGAAATTTATGATGTATGTTGGGATCATTGCCTACTACCAACTGATGCAAGTTTGCCAGGCTGAATATTTTCGTCAGTTGCTTAAACCTGTTACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.76

Weight (kDa)

9.58

Isoelectric Point (pI)

20.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 53
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AlwI GGATC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 53
Asp700I GAANNNNTTC 1 cut(s) 117
BciT130I CCWGG 1 cut(s) 107
Bme1390I CCNGG 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 107
BmsI GCATC 1 cut(s) 84
BsaAI YACGTR 1 cut(s) 144
Bse3DI GCAATG 1 cut(s) 75
BseBI CCWGG 1 cut(s) 107
BseMI GCAATG 1 cut(s) 75
Bsp143I GATC 1 cut(s) 72
BspPI GGATC 1 cut(s) 80
BsrDI GCAATG 1 cut(s) 75
BssMI GATC 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 107
BstBAI YACGTR 1 cut(s) 144
BstEII GGTNACC 1 cut(s) 13
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstNI CCWGG 1 cut(s) 107
BstPI GGTNACC 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 105
BstSNI TACGTA 1 cut(s) 144
CviJI RGCY 2 cut(s) 35, 110
CviKI_1 RGCY 2 cut(s) 35, 110
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eco105I TACGTA 1 cut(s) 144
Eco91I GGTNACC 1 cut(s) 13
EcoO65I GGTNACC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 105
FaiI YATR 4 cut(s) 6, 20, 59, 66
Hpy188III TCNNGA 1 cut(s) 41
HpyCH4IV ACGT 2 cut(s) 45, 143
HpyCH4V TGCA 1 cut(s) 97
HpySE526I ACGT 2 cut(s) 45, 143
Kzo9I GATC 1 cut(s) 72
LpnPI CCDG 3 cut(s) 26, 92, 119
LweI GCATC 1 cut(s) 84
MaeII ACGT 2 cut(s) 45, 143
MaeIII GTNAC 2 cut(s) 13, 139
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MluCI AATT 1 cut(s) 53
MroXI GAANNNNTTC 1 cut(s) 117
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
NdeII GATC 1 cut(s) 72
PdmI GAANNNNTTC 1 cut(s) 117
Ppu21I YACGTR 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 105
PspEI GGTNACC 1 cut(s) 13
PspGI CCWGG 1 cut(s) 105
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 107
SetI ASST 4 cut(s) 37, 48, 139, 146
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 4 cut(s) 53, 110, 118, 119
SnaBI TACGTA 1 cut(s) 144
Sse9I AATT 1 cut(s) 53
SspI AATATT 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 105
TaiI ACGT 2 cut(s) 48, 146
TasI AATT 1 cut(s) 53
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
XapI RAATTY 1 cut(s) 53
XmnI GAANNNNTTC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.