RchiOBHm_Chr4g0386271

Protein of unknown function (DUF760)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
1805837 .. 1806915
1079 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
ATGGGTCGAAGATCGATGGGAGTTCGGAGACGGGGGGATAGTGAGGAAAGGGATAGCGAGAATGGATTTGGGGCGAGTAATCAATACCTGGGCTCAACAAGTCCTCAAGTTTTCGGGGATTTGTCTCCGGAGGCTTTGAATTACATCCAGAGGTTGCAATCAGAGTTAACTAATGTTAAGGAGATTTCAAGAACTTCACGAGATTACCTAGCGAAGGTTCTTTTCTGGTGTATGTTATTAGGTCATCATTTGAGAGGCTTGGAGAACAGATTACATTTGAGTTGTGTTGTTGGATTGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.33

Weight (kDa)

8.77

Isoelectric Point (pI)

68.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF760 PF05542 43 - 96 1.8e-11 Protein of unknown function (DUF760)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 214
AgsI TTSAA 2 cut(s) 139, 189
AjnI CCWGG 1 cut(s) 87
Alw26I GTCTC 2 cut(s) 22, 129
Aor13HI TCCGGA 1 cut(s) 127
BanII GRGCYC 1 cut(s) 95
BauI CACGAG 1 cut(s) 198
BccI CCATC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 89
BcoDI GTCTC 2 cut(s) 22, 129
BfaI CTAG 1 cut(s) 209
Bme1390I CCNGG 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 89
BpuEI CTTGAG 1 cut(s) 90
Bsa29I ATCGAT 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 88
BsaWI WCCGGW 1 cut(s) 127
Bsc4I CCNNNNNNNGG 1 cut(s) 214
BseAI TCCGGA 1 cut(s) 127
BseBI CCWGG 1 cut(s) 89
BseCI ATCGAT 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 214
BshVI ATCGAT 1 cut(s) 14
BsiSI CCGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 214
BsmAI GTCTC 2 cut(s) 22, 129
BsmBI CGTCTC 1 cut(s) 22
Bsp1286I GDGCHC 1 cut(s) 95
Bsp13I TCCGGA 1 cut(s) 127
Bsp143I GATC 1 cut(s) 11
BspDI ATCGAT 1 cut(s) 14
BspEI TCCGGA 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 11
BssSI CACGAG 1 cut(s) 198
Bst2BI CACGAG 1 cut(s) 198
Bst2UI CCWGG 1 cut(s) 89
BstENI CCTNNNNNAGG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 144
BstKTI GATC 1 cut(s) 14
BstMAI GTCTC 2 cut(s) 22, 129
BstMBI GATC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 87
Bsu15I ATCGAT 1 cut(s) 14
BsuTUI ATCGAT 1 cut(s) 14
BtsCI GGATG 1 cut(s) 144
ClaI ATCGAT 1 cut(s) 14
CviJI RGCY 3 cut(s) 93, 134, 258
CviKI_1 RGCY 3 cut(s) 93, 134, 258
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
Eco24I GRGCYC 1 cut(s) 95
EcoNI CCTNNNNNAGG 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 87
EcoT38I GRGCYC 1 cut(s) 95
Esp3I CGTCTC 1 cut(s) 22
FaiI YATR 1 cut(s) 233
FokI GGATG 1 cut(s) 131
FriOI GRGCYC 1 cut(s) 95
FspBI CTAG 1 cut(s) 209
HapII CCGG 1 cut(s) 128
HincII GTYRAC 1 cut(s) 168
HindII GTYRAC 1 cut(s) 168
HpaI GTTAAC 1 cut(s) 168
HpaII CCGG 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 168
Hpy188I TCNGA 2 cut(s) 27, 163
Hpy188III TCNNGA 4 cut(s) 128, 148, 189, 198
Hpy8I GTNNAC 1 cut(s) 168
HpyAV CCTTC 1 cut(s) 208
HpyCH4V TGCA 1 cut(s) 157
Kpn2I TCCGGA 1 cut(s) 127
KspAI GTTAAC 1 cut(s) 168
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 5 cut(s) 74, 101, 141, 161, 211
MaeI CTAG 1 cut(s) 209
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 21
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 1 cut(s) 139
MmeI TCCRAC 1 cut(s) 271
MnlI CCTC 5 cut(s) 37, 114, 124, 144, 248
MroI TCCGGA 1 cut(s) 127
MseI TTAA 2 cut(s) 167, 177
MspI CCGG 1 cut(s) 128
MspR9I CCNGG 1 cut(s) 89
MvaI CCWGG 1 cut(s) 89
NdeII GATC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 87
PspGI CCWGG 1 cut(s) 87
SaqAI TTAA 2 cut(s) 167, 177
Sau3AI GATC 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 89
SduI GDGCHC 1 cut(s) 95
SetI ASST 5 cut(s) 90, 155, 210, 219, 244
SmlI CTYRAG 1 cut(s) 105
SmoI CTYRAG 1 cut(s) 105
Sse9I AATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 87
TaqI TCGA 2 cut(s) 7, 14
TasI AATT 1 cut(s) 139
Tru1I TTAA 2 cut(s) 167, 177
Tru9I TTAA 2 cut(s) 167, 177
XagI CCTNNNNNAGG 1 cut(s) 212
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.