RchiOBHm_Chr4g0392931

Seems to be required for maximal rate of protein biosynthesis. Enhances ribosome dissociation into subunits and stabilizes the binding of the initiator Met-tRNA(I) to 40 S ribosomal subunits

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
8447522 .. 8448347
826 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
ATGAATTCTTTTTATGGGGTTAGGCAAACTGAATTATGTGAATTACTTTCTGGTGTGTTACTAATATACAAAACTGCACACCCAAAAGTTTGCTTCTTGTTTGTTTTTGTCTTCTTGTTGGTTTGGATTGCAGCTGGGCATATCATTCTTGTTGGCCTTCGTGACTATCAGGATGACAAAGCTGATTTGATTCTCAAGTACATGTCTGATGAGGCTAGGCTGCTGAAGGCTTATGGAGAGCTTCCAGAGAATACACGTCTTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.14

Weight (kDa)

6.71

Isoelectric Point (pI)

34.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AcuI CTGAAG 1 cut(s) 245
AfaI GTAC 1 cut(s) 200
AflIII ACRYGT 2 cut(s) 201, 254
AjiI CACGTC 1 cut(s) 257
AluBI AGCT 3 cut(s) 134, 182, 241
AluI AGCT 3 cut(s) 134, 182, 241
AoxI GGCC 1 cut(s) 154
ApeKI GCWGC 2 cut(s) 131, 220
ApoI RAATTY 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 103
BbvI GCAGC 2 cut(s) 143, 207
BfaI CTAG 1 cut(s) 216
BisI GCNGC 2 cut(s) 132, 221
BlsI GCNGC 2 cut(s) 133, 222
BmgBI CACGTC 1 cut(s) 257
BpiI GAAGAC 1 cut(s) 103
BpuEI CTTGAG 1 cut(s) 179
BseGI GGATG 1 cut(s) 178
BseXI GCAGC 2 cut(s) 143, 207
BseYI CCCAGC 1 cut(s) 134
BsgI GTGCAG 1 cut(s) 60
BshFI GGCC 1 cut(s) 156
BsnI GGCC 1 cut(s) 156
BspANI GGCC 1 cut(s) 156
BstF5I GGATG 1 cut(s) 178
BstNSI RCATGY 1 cut(s) 205
BstV1I GCAGC 2 cut(s) 143, 207
BstV2I GAAGAC 1 cut(s) 103
BsuRI GGCC 1 cut(s) 156
BtrI CACGTC 1 cut(s) 257
BtsCI GGATG 1 cut(s) 178
Csp6I GTAC 1 cut(s) 199
CviAII CATG 1 cut(s) 202
CviJI RGCY 7 cut(s) 134, 156, 182, 215, 220, 230, 241
CviKI_1 RGCY 7 cut(s) 134, 156, 182, 215, 220, 230, 241
CviQI GTAC 1 cut(s) 199
Eco57I CTGAAG 1 cut(s) 245
EcoRI GAATTC 1 cut(s) 4
FaeI CATG 1 cut(s) 205
FaiI YATR 6 cut(s) 15, 37, 67, 141, 203, 234
FatI CATG 1 cut(s) 201
Fnu4HI GCNGC 2 cut(s) 132, 221
FokI GGATG 1 cut(s) 185
Fsp4HI GCNGC 2 cut(s) 132, 221
FspBI CTAG 1 cut(s) 216
GluI GCNGC 2 cut(s) 132, 221
GsaI CCCAGC 1 cut(s) 138
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 1 cut(s) 205
HinfI GANTC 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 208
Hpy188III TCNNGA 3 cut(s) 161, 170, 245
HpyAV CCTTC 2 cut(s) 167, 220
HpyCH4IV ACGT 1 cut(s) 256
HpyCH4V TGCA 2 cut(s) 77, 131
HpySE526I ACGT 1 cut(s) 256
Hsp92II CATG 1 cut(s) 205
LpnPI CCDG 4 cut(s) 36, 120, 155, 258
Lsp1109I GCAGC 2 cut(s) 143, 207
MaeI CTAG 1 cut(s) 216
MaeII ACGT 1 cut(s) 256
MaeIII GTNAC 2 cut(s) 57, 161
MboII GAAGA 1 cut(s) 103
MluCI AATT 3 cut(s) 4, 32, 41
MnlI CCTC 1 cut(s) 205
MseI TTAA 1 cut(s) 261
MspA1I CMGCKG 1 cut(s) 134
NlaIII CATG 1 cut(s) 205
NmuCI GTSAC 1 cut(s) 161
NspI RCATGY 1 cut(s) 205
PciI ACATGT 1 cut(s) 201
PfeI GAWTC 1 cut(s) 190
PkrI GCNGC 2 cut(s) 133, 222
PscI ACATGT 1 cut(s) 201
PspFI CCCAGC 1 cut(s) 134
PvuII CAGCTG 1 cut(s) 134
RsaI GTAC 1 cut(s) 200
RsaNI GTAC 1 cut(s) 199
SaqAI TTAA 1 cut(s) 261
SatI GCNGC 2 cut(s) 132, 221
SetI ASST 4 cut(s) 136, 184, 243, 259
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 3 cut(s) 4, 32, 41
SspMI CTAG 1 cut(s) 216
TaiI ACGT 1 cut(s) 259
TasI AATT 3 cut(s) 4, 32, 41
TatI WGTACW 1 cut(s) 198
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TseFI GTSAC 1 cut(s) 161
TseI GCWGC 2 cut(s) 131, 220
Tsp45I GTSAC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 4
XceI RCATGY 1 cut(s) 205
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.