Rmu_sc0000195.1_g000029

Seems to be required for maximal rate of protein biosynthesis. Enhances ribosome dissociation into subunits and stabilizes the binding of the initiator Met-tRNA(I) to 40 S ribosomal subunits

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000195.1
OG0003208
Physical Location & Seq
Reverse (-)
98565 .. 100274
1710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000195.1_g000029.1.cds

Sequence Viewer

Length: 609 bp
atgcgtgtgcatgcctgcatatacatagctagcttagccagtagagccagaagagctatcacctttgtcaatggtcgtaagcatccttcatccttgggcgttcgtgttgtcctctctcgcatccaaaactcccttcaactttccctaaccagagaagcagaaccagtaatcatgccgaagaacaagggaaagggaggaaagaacaggaagagaggaaagaacgaggctgatgacgaaaagcgtgagcttgtcttcaaggaagatggacaggagtatgcccaagtgcttcggatgctgggtaatggtcggtgcgaagccatgtgcattgatggaaccaagcgactttgccatatccgtggtaagatgcacaagaaggtttggattgcagctggggatatcattcttgttgggcttcgtgactatcaggatgacaaggccgatgtgattctcaagtacatgcctgatgaggctaggctgctgaaggcttatggagagcttccagagaatacacgtcttaacgagggtattactgggggtcttgatgaggaggaggaaggtggtgctgatgactacatcgagtttgaagatgaggatattgataagatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
eIF-1a

Protein Analysis

202

Amino Acids

22.79

Weight (kDa)

6.92

Isoelectric Point (pI)

50.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 500
AfaI GTAC 1 cut(s) 455
AflIII ACRYGT 1 cut(s) 509
AgsI TTSAA 3 cut(s) 137, 256, 584
AjiI CACGTC 1 cut(s) 512
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 6 cut(s) 29, 33, 56, 247, 389, 496
AluI AGCT 6 cut(s) 29, 33, 56, 247, 389, 496
AoxI GGCC 1 cut(s) 435
ApeKI GCWGC 2 cut(s) 386, 475
AsuHPI GGTGA 1 cut(s) 52
AsuNHI GCTAGC 1 cut(s) 29
BarI GAAGNNNNNNTAC 2 cut(s) 70, 102
BbsI GAAGAC 1 cut(s) 244
BbvI GCAGC 2 cut(s) 398, 462
BccI CCATC 2 cut(s) 257, 323
BfaI CTAG 2 cut(s) 30, 471
BisI GCNGC 2 cut(s) 387, 476
BlpI GCTNAGC 1 cut(s) 34
BlsI GCNGC 2 cut(s) 388, 477
BmgBI CACGTC 1 cut(s) 512
BmiI GGNNCC 1 cut(s) 334
BmrI ACTGGG 1 cut(s) 540
BmsI GCATC 4 cut(s) 91, 129, 282, 354
BmtI GCTAGC 1 cut(s) 33
BmuI ACTGGG 1 cut(s) 540
BpiI GAAGAC 1 cut(s) 244
Bpu1102I GCTNAGC 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 434
BsaJI CCNNGG 2 cut(s) 93, 355
Bse1I ACTGG 3 cut(s) 39, 164, 535
BseDI CCNNGG 2 cut(s) 93, 355
BseGI GGATG 5 cut(s) 82, 89, 120, 297, 433
BseNI ACTGG 3 cut(s) 39, 164, 535
BseRI GAGGAG 2 cut(s) 560, 563
BseXI GCAGC 2 cut(s) 398, 462
BseYI CCCAGC 2 cut(s) 295, 389
BshFI GGCC 1 cut(s) 437
BsnI GGCC 1 cut(s) 437
Bsp1720I GCTNAGC 1 cut(s) 34
BspANI GGCC 1 cut(s) 437
BspLI GGNNCC 1 cut(s) 334
BspOI GCTAGC 1 cut(s) 33
BspQI GCTCTTC 1 cut(s) 46
BsrI ACTGG 3 cut(s) 39, 164, 535
BssECI CCNNGG 2 cut(s) 93, 355
BssT1I CCWWGG 1 cut(s) 93
Bst6I CTCTTC 2 cut(s) 46, 203
BstC8I GCNNGC 3 cut(s) 12, 16, 31
BstDEI CTNAG 1 cut(s) 34
BstDSI CCRYGG 1 cut(s) 355
BstF5I GGATG 5 cut(s) 82, 89, 120, 297, 433
BstMWI GCNNNNNNNGC 4 cut(s) 35, 44, 53, 292
BstNSI RCATGY 2 cut(s) 14, 460
BstV1I GCAGC 2 cut(s) 398, 462
BstV2I GAAGAC 1 cut(s) 244
BstXI CCANNNNNNTGG 1 cut(s) 356
BsuRI GGCC 1 cut(s) 437
BtgI CCRYGG 1 cut(s) 355
BtrI CACGTC 1 cut(s) 512
BtsCI GGATG 5 cut(s) 82, 89, 120, 297, 433
Cac8I GCNNGC 3 cut(s) 12, 16, 31
Csp6I GTAC 1 cut(s) 454
CviAII CATG 4 cut(s) 11, 172, 319, 457
CviQI GTAC 1 cut(s) 454
DdeI CTNAG 1 cut(s) 34
Eam1104I CTCTTC 2 cut(s) 46, 203
EarI CTCTTC 2 cut(s) 46, 203
Eco130I CCWWGG 1 cut(s) 93
Eco32I GATATC 1 cut(s) 397
Eco57I CTGAAG 1 cut(s) 500
EcoRV GATATC 1 cut(s) 397
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 4 cut(s) 14, 175, 322, 460
FatI CATG 4 cut(s) 10, 171, 318, 456
Fnu4HI GCNGC 2 cut(s) 387, 476
FokI GGATG 5 cut(s) 69, 76, 107, 304, 440
Fsp4HI GCNGC 2 cut(s) 387, 476
FspBI CTAG 2 cut(s) 30, 471
GluI GCNGC 2 cut(s) 387, 476
GsaI CCCAGC 2 cut(s) 299, 393
HaeIII GGCC 1 cut(s) 437
Hin1II CATG 4 cut(s) 14, 175, 322, 460
HinfI GANTC 1 cut(s) 445
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 291
Hpy188III TCNNGA 4 cut(s) 416, 425, 500, 539
HpyAV CCTTC 5 cut(s) 96, 143, 367, 475, 548
HpyCH4IV ACGT 1 cut(s) 511
HpyCH4V TGCA 5 cut(s) 10, 18, 324, 367, 386
HpyF10VI GCNNNNNNNGC 4 cut(s) 35, 44, 53, 292
HpyF3I CTNAG 1 cut(s) 34
HpySE526I ACGT 1 cut(s) 511
Hsp92II CATG 4 cut(s) 14, 175, 322, 460
LguI GCTCTTC 1 cut(s) 46
Lsp1109I GCAGC 2 cut(s) 398, 462
LweI GCATC 4 cut(s) 91, 129, 282, 354
MaeI CTAG 2 cut(s) 30, 471
MaeII ACGT 1 cut(s) 511
MaeIII GTNAC 1 cut(s) 416
MboII GAAGA 6 cut(s) 63, 190, 220, 244, 272, 596
MseI TTAA 2 cut(s) 516, 607
MslI CAYNNNNRTG 1 cut(s) 354
MspA1I CMGCKG 1 cut(s) 389
MwoI GCNNNNNNNGC 4 cut(s) 35, 44, 53, 292
NheI GCTAGC 1 cut(s) 29
NlaIII CATG 4 cut(s) 14, 175, 322, 460
NlaIV GGNNCC 1 cut(s) 334
NmuCI GTSAC 1 cut(s) 416
NspI RCATGY 2 cut(s) 14, 460
PaeI GCATGC 1 cut(s) 14
PciSI GCTCTTC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 445
PkrI GCNGC 2 cut(s) 388, 477
PspFI CCCAGC 2 cut(s) 295, 389
PspN4I GGNNCC 1 cut(s) 334
PvuII CAGCTG 1 cut(s) 389
RsaI GTAC 1 cut(s) 455
RsaNI GTAC 1 cut(s) 454
RseI CAYNNNNRTG 1 cut(s) 354
SapI GCTCTTC 1 cut(s) 46
SaqAI TTAA 2 cut(s) 516, 607
SatI GCNGC 2 cut(s) 387, 476
SfaNI GCATC 4 cut(s) 91, 129, 282, 354
SmiMI CAYNNNNRTG 1 cut(s) 354
SmlI CTYRAG 1 cut(s) 449
SmoI CTYRAG 1 cut(s) 449
SphI GCATGC 1 cut(s) 14
SspMI CTAG 2 cut(s) 30, 471
StyI CCWWGG 1 cut(s) 93
TaiI ACGT 1 cut(s) 514
TaqI TCGA 1 cut(s) 576
TatI WGTACW 1 cut(s) 453
TfiI GAWTC 1 cut(s) 445
Tru1I TTAA 2 cut(s) 516, 607
Tru9I TTAA 2 cut(s) 516, 607
TseFI GTSAC 1 cut(s) 416
TseI GCWGC 2 cut(s) 386, 475
Tsp45I GTSAC 1 cut(s) 416
TspDTI ATGAA 1 cut(s) 78
TspGWI ACGGA 1 cut(s) 344
XceI RCATGY 2 cut(s) 14, 460
XspI CTAG 2 cut(s) 30, 471
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.