Rorug02G0329800

Seems to be required for maximal rate of protein biosynthesis. Enhances ribosome dissociation into subunits and stabilizes the binding of the initiator Met-tRNA(I) to 40 S ribosomal subunits

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
40597060 .. 40598426
1367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0329800.1

Sequence Viewer

Length: 345 bp
ATGCCAAGTCATGCCAACCTTTTCAATGATGCCATGGCTAGTGATAATCGTTTGATGACCAGCGTGTTACTTAAAGAGTGCAAGGGGGTATTCGAGGGATTGAAATCATTAGTTGATGTTGGGGGTGGTACAGGAACAATGGCCAAGGCCATTGTTGATGCATTCCCAGAAATTGACTGCACCGTACTTGATCTACCCCATGTGGTGGCTGATCTGCAAGGAAGTAAGAACTTGAAATATGCTGGAGGGGACATGTTTGAGGCAGTTCCTCCGGCAGTTGCAATTATGTTGAAGGTAAATCTCATCAATACTCTGTTGTTAGTCATGTTCTCATATTGTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.17

Weight (kDa)

4.88

Isoelectric Point (pI)

34.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 4 - 99 1.4e-23 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 205
AcoI YGGCCR 1 cut(s) 141
AfaI GTAC 2 cut(s) 130, 186
AfiI CCNNNNNNNGG 1 cut(s) 205
AflIII ACRYGT 1 cut(s) 252
AgsI TTSAA 4 cut(s) 25, 103, 235, 292
AoxI GGCC 2 cut(s) 141, 147
BalI TGGCCA 1 cut(s) 143
BfaI CTAG 1 cut(s) 39
BmsI GCATC 2 cut(s) 19, 148
BpmI CTGGAG 1 cut(s) 264
BsaBI GATNNNNATC 1 cut(s) 103
BsaJI CCNNGG 2 cut(s) 33, 144
Bsc4I CCNNNNNNNGG 1 cut(s) 205
Bse8I GATNNNNATC 1 cut(s) 103
BseDI CCNNGG 2 cut(s) 33, 144
BseJI GATNNNNATC 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 205
BsgI GTGCAG 1 cut(s) 163
BshFI GGCC 2 cut(s) 143, 149
BsiSI CCGG 1 cut(s) 272
BslFI GGGAC 1 cut(s) 263
BslI CCNNNNNNNGG 1 cut(s) 205
BsmFI GGGAC 1 cut(s) 263
BsmI GAATGC 1 cut(s) 161
BsnI GGCC 2 cut(s) 143, 149
Bsp143I GATC 2 cut(s) 190, 211
Bsp19I CCATGG 1 cut(s) 33
BspANI GGCC 2 cut(s) 143, 149
BssECI CCNNGG 2 cut(s) 33, 144
BssMI GATC 2 cut(s) 190, 211
BssT1I CCWWGG 2 cut(s) 33, 144
Bst4CI ACNGT 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 33
BstKTI GATC 2 cut(s) 193, 214
BstMBI GATC 2 cut(s) 190, 211
BstNSI RCATGY 1 cut(s) 256
BsuRI GGCC 2 cut(s) 143, 149
BtgI CCRYGG 1 cut(s) 33
Csp6I GTAC 2 cut(s) 129, 185
CviAII CATG 5 cut(s) 11, 34, 200, 253, 325
CviJI RGCY 4 cut(s) 38, 143, 149, 209
CviKI_1 RGCY 4 cut(s) 38, 143, 149, 209
CviQI GTAC 2 cut(s) 129, 185
DpnI GATC 2 cut(s) 192, 213
DpnII GATC 2 cut(s) 190, 211
EaeI YGGCCR 1 cut(s) 141
Eco130I CCWWGG 2 cut(s) 33, 144
EcoT14I CCWWGG 2 cut(s) 33, 144
EcoT22I ATGCAT 1 cut(s) 163
ErhI CCWWGG 2 cut(s) 33, 144
FaeI CATG 5 cut(s) 14, 37, 203, 256, 328
FaiI YATR 9 cut(s) 12, 35, 201, 240, 254, 287, 326, 334, 341
FaqI GGGAC 1 cut(s) 263
FatI CATG 5 cut(s) 10, 33, 199, 252, 324
FspBI CTAG 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 264
HaeIII GGCC 2 cut(s) 143, 149
HapII CCGG 1 cut(s) 272
Hin1II CATG 5 cut(s) 14, 37, 203, 256, 328
HpaII CCGG 1 cut(s) 272
HpyAV CCTTC 1 cut(s) 286
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4V TGCA 5 cut(s) 81, 161, 180, 217, 281
Hsp92II CATG 5 cut(s) 14, 37, 203, 256, 328
Kzo9I GATC 2 cut(s) 190, 211
LpnPI CCDG 5 cut(s) 73, 117, 180, 228, 285
LweI GCATC 2 cut(s) 19, 148
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 66
MalI GATC 2 cut(s) 192, 213
MboI GATC 2 cut(s) 190, 211
MlsI TGGCCA 1 cut(s) 143
MluCI AATT 2 cut(s) 171, 282
MluNI TGGCCA 1 cut(s) 143
MnlI CCTC 4 cut(s) 88, 239, 253, 279
Mox20I TGGCCA 1 cut(s) 143
Mph1103I ATGCAT 1 cut(s) 163
MscI TGGCCA 1 cut(s) 143
MseI TTAA 1 cut(s) 72
Msp20I TGGCCA 1 cut(s) 143
MspI CCGG 1 cut(s) 272
Mva1269I GAATGC 1 cut(s) 161
NcoI CCATGG 1 cut(s) 33
NdeII GATC 2 cut(s) 190, 211
NlaIII CATG 5 cut(s) 14, 37, 203, 256, 328
NsiI ATGCAT 1 cut(s) 163
NspI RCATGY 1 cut(s) 256
PciI ACATGT 1 cut(s) 252
PctI GAATGC 1 cut(s) 161
PflMI CCANNNNNTGG 1 cut(s) 205
PscI ACATGT 1 cut(s) 252
RsaI GTAC 2 cut(s) 130, 186
RsaNI GTAC 2 cut(s) 129, 185
SaqAI TTAA 1 cut(s) 72
Sau3AI GATC 2 cut(s) 190, 211
SetI ASST 2 cut(s) 21, 297
SfaNI GCATC 2 cut(s) 19, 148
Sse9I AATT 2 cut(s) 171, 282
SspMI CTAG 1 cut(s) 39
StyI CCWWGG 2 cut(s) 33, 144
TaaI ACNGT 1 cut(s) 184
TaqI TCGA 1 cut(s) 93
TasI AATT 2 cut(s) 171, 282
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 205
XceI RCATGY 1 cut(s) 256
XspI CTAG 1 cut(s) 39
Zsp2I ATGCAT 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.