Rmu_sc0001998.1_g000014

Seems to be required for maximal rate of protein biosynthesis. Enhances ribosome dissociation into subunits and stabilizes the binding of the initiator Met-tRNA(I) to 40 S ribosomal subunits

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001998.1
Physical Location & Seq
Reverse (-)
46917 .. 47351
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001998.1_g000014.1.cds

Sequence Viewer

Length: 435 bp
atgccaaagaacaagggaaagggaggaaagaacaggaagagaggtaagaacgaggctgacgacgaaaagcgtgagcttgtcttcaaggaagatggacaggagtatgcccaagtgcttcgcatgctgggtaatggtcggtgcgaagccatgtgcattgatggacccaagcgactttgccatatccgtggtaagatgcacaagaaggtttggattgcagctggggatatcattcttgttggccttcgtgactatcaggatgacaaggctgatgtcattctcaagtacatgcctgatgaggctaggctgctcaaggcttatggagagctttcagaaaatgtacgtcttaacgagggtgttggtagtcttgaagatggcaatgaaggtgctgctgatgactacctcgagtttgaggatgaagacattgataagatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

144

Amino Acids

16.29

Weight (kDa)

5.21

Isoelectric Point (pI)

40.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 284, 339
AgsI TTSAA 2 cut(s) 85, 368
AluBI AGCT 3 cut(s) 76, 218, 325
AluI AGCT 3 cut(s) 76, 218, 325
Ama87I CYCGRG 1 cut(s) 401
AoxI GGCC 1 cut(s) 238
ApeKI GCWGC 3 cut(s) 215, 304, 386
AspS9I GGNCC 1 cut(s) 161
AvaI CYCGRG 1 cut(s) 401
AvaII GGWCC 1 cut(s) 161
BbsI GAAGAC 2 cut(s) 73, 423
BbvI GCAGC 3 cut(s) 227, 291, 373
BccI CCATC 3 cut(s) 86, 152, 365
BfaI CTAG 1 cut(s) 300
BisI GCNGC 3 cut(s) 216, 305, 387
BlsI GCNGC 3 cut(s) 217, 306, 388
Bme18I GGWCC 1 cut(s) 161
BmeT110I CYCGRG 1 cut(s) 401
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 163
BmsI GCATC 1 cut(s) 183
BpiI GAAGAC 2 cut(s) 73, 423
BpuEI CTTGAG 2 cut(s) 263, 293
BsaJI CCNNGG 1 cut(s) 184
Bse3DI GCAATG 1 cut(s) 382
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 2 cut(s) 262, 418
BseMI GCAATG 1 cut(s) 382
BseXI GCAGC 3 cut(s) 227, 291, 373
BseYI CCCAGC 2 cut(s) 124, 218
BshFI GGCC 1 cut(s) 240
BsiHKCI CYCGRG 1 cut(s) 401
BsnI GGCC 1 cut(s) 240
BsoBI CYCGRG 1 cut(s) 401
BspANI GGCC 1 cut(s) 240
BspLI GGNNCC 1 cut(s) 163
BsrDI GCAATG 1 cut(s) 382
BssECI CCNNGG 1 cut(s) 184
Bst6I CTCTTC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 122
BstDSI CCRYGG 1 cut(s) 184
BstF5I GGATG 2 cut(s) 262, 418
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNSI RCATGY 2 cut(s) 124, 289
BstV1I GCAGC 3 cut(s) 227, 291, 373
BstV2I GAAGAC 2 cut(s) 73, 423
BstXI CCANNNNNNTGG 1 cut(s) 185
BsuRI GGCC 1 cut(s) 240
BtgI CCRYGG 1 cut(s) 184
BtsCI GGATG 2 cut(s) 262, 418
Cac8I GCNNGC 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 161
Csp6I GTAC 2 cut(s) 283, 338
CviAII CATG 3 cut(s) 121, 148, 286
CviQI GTAC 2 cut(s) 283, 338
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco32I GATATC 1 cut(s) 226
Eco47I GGWCC 1 cut(s) 161
Eco88I CYCGRG 1 cut(s) 401
EcoRV GATATC 1 cut(s) 226
FaeI CATG 3 cut(s) 124, 151, 289
FaiI YATR 6 cut(s) 105, 122, 149, 180, 287, 318
FatI CATG 3 cut(s) 120, 147, 285
Fnu4HI GCNGC 3 cut(s) 216, 305, 387
FokI GGATG 2 cut(s) 269, 425
Fsp4HI GCNGC 3 cut(s) 216, 305, 387
FspBI CTAG 1 cut(s) 300
GluI GCNGC 3 cut(s) 216, 305, 387
GsaI CCCAGC 2 cut(s) 128, 222
HaeIII GGCC 1 cut(s) 240
Hin1II CATG 3 cut(s) 124, 151, 289
Hpy188I TCNGA 1 cut(s) 331
Hpy188III TCNNGA 3 cut(s) 245, 254, 365
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 3 cut(s) 196, 251, 374
HpyCH4IV ACGT 1 cut(s) 340
HpyCH4V TGCA 3 cut(s) 153, 196, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpySE526I ACGT 1 cut(s) 340
Hsp92II CATG 3 cut(s) 124, 151, 289
LpnPI CCDG 6 cut(s) 19, 83, 110, 204, 239, 303
Lsp1109I GCAGC 3 cut(s) 227, 291, 373
LweI GCATC 1 cut(s) 183
MaeI CTAG 1 cut(s) 300
MaeII ACGT 1 cut(s) 340
MaeIII GTNAC 1 cut(s) 245
MboII GAAGA 5 cut(s) 49, 73, 101, 380, 428
MnlI CCTC 7 cut(s) 17, 35, 46, 289, 343, 403, 410
MseI TTAA 2 cut(s) 345, 433
MslI CAYNNNNRTG 1 cut(s) 183
MspA1I CMGCKG 1 cut(s) 218
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 3 cut(s) 124, 151, 289
NlaIV GGNNCC 1 cut(s) 163
NmuCI GTSAC 1 cut(s) 245
NspI RCATGY 2 cut(s) 124, 289
PaeI GCATGC 1 cut(s) 124
PaeR7I CTCGAG 1 cut(s) 401
PcsI WCGNNNNNNNCGW 1 cut(s) 57
PkrI GCNGC 3 cut(s) 217, 306, 388
PspFI CCCAGC 2 cut(s) 124, 218
PspN4I GGNNCC 1 cut(s) 163
PspPI GGNCC 1 cut(s) 161
PspXI VCTCGAGB 1 cut(s) 401
PvuII CAGCTG 1 cut(s) 218
RsaI GTAC 2 cut(s) 284, 339
RsaNI GTAC 2 cut(s) 283, 338
RseI CAYNNNNRTG 1 cut(s) 183
SaqAI TTAA 2 cut(s) 345, 433
SatI GCNGC 3 cut(s) 216, 305, 387
Sau96I GGNCC 1 cut(s) 161
SetI ASST 8 cut(s) 46, 78, 207, 220, 327, 343, 385, 402
SfaNI GCATC 1 cut(s) 183
Sfr274I CTCGAG 1 cut(s) 401
SinI GGWCC 1 cut(s) 161
SlaI CTCGAG 1 cut(s) 401
SmiMI CAYNNNNRTG 1 cut(s) 183
SmlI CTYRAG 3 cut(s) 278, 308, 401
SmoI CTYRAG 3 cut(s) 278, 308, 401
SphI GCATGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 300
TaiI ACGT 1 cut(s) 343
TaqI TCGA 1 cut(s) 402
TatI WGTACW 1 cut(s) 282
Tru1I TTAA 2 cut(s) 345, 433
Tru9I TTAA 2 cut(s) 345, 433
TseFI GTSAC 1 cut(s) 245
TseI GCWGC 3 cut(s) 215, 304, 386
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 2 cut(s) 393, 429
TspGWI ACGGA 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 161
XceI RCATGY 2 cut(s) 124, 289
XhoI CTCGAG 1 cut(s) 401
XspI CTAG 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.