RchiOBHm_Chr4g0435401

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
58980661 .. 58980877
217 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGTTGGGTATCTGTCTAACCCACACAATGGTCATTCCCAATCCGGTTAAGTGTTCACCATGGGAAAAGACCGTGATATCTTGGAGGTCTACAGAACAGACCGTAGTCGCTATATCTTCGAACAATGCAGAGATCATTGCTCTTCACGAAGTGGTTCGTGAATGTATATGGATTGGATCCATAGTTACGCATGTTCGAACAATTGTGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.81

Weight (kDa)

6.81

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 28
AccI GTMKAC 1 cut(s) 89
AclWI GGATC 2 cut(s) 171, 184
AdeI CACNNNGTG 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 28
AlwI GGATC 2 cut(s) 171, 184
Asp700I GAANNNNTTC 1 cut(s) 153
AsuHPI GGTGA 1 cut(s) 48
AsuII TTCGAA 2 cut(s) 119, 196
BamHI GGATCC 1 cut(s) 176
BfmI CTRYAG 1 cut(s) 90
BmiI GGNNCC 1 cut(s) 178
BoxI GACNNNNGTC 1 cut(s) 104
Bpu14I TTCGAA 2 cut(s) 119, 196
BsaJI CCNNGG 1 cut(s) 59
BsaWI WCCGGW 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse3DI GCAATG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMI GCAATG 1 cut(s) 135
BsiSI CCGG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 28
Bsp119I TTCGAA 2 cut(s) 119, 196
Bsp143I GATC 2 cut(s) 132, 176
Bsp19I CCATGG 1 cut(s) 59
BspLI GGNNCC 1 cut(s) 178
BspPI GGATC 2 cut(s) 171, 184
BspQI GCTCTTC 1 cut(s) 147
BspT104I TTCGAA 2 cut(s) 119, 196
BsrDI GCAATG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 2 cut(s) 132, 176
BssT1I CCWWGG 1 cut(s) 59
Bst4CI ACNGT 2 cut(s) 73, 103
Bst6I CTCTTC 1 cut(s) 147
BstBI TTCGAA 2 cut(s) 119, 196
BstDSI CCRYGG 1 cut(s) 59
BstKTI GATC 2 cut(s) 135, 179
BstMBI GATC 2 cut(s) 132, 176
BstNSI RCATGY 1 cut(s) 194
BstPAI GACNNNNGTC 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 176
BstYI RGATCY 1 cut(s) 176
BtgI CCRYGG 1 cut(s) 59
CviAII CATG 2 cut(s) 60, 191
DpnI GATC 2 cut(s) 134, 178
DpnII GATC 2 cut(s) 132, 176
DraIII CACNNNGTG 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 59
Eco32I GATATC 1 cut(s) 78
EcoRV GATATC 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaeI CATG 2 cut(s) 63, 194
FaiI YATR 6 cut(s) 61, 113, 167, 169, 182, 192
FatI CATG 2 cut(s) 59, 190
FblI GTMKAC 1 cut(s) 89
HapII CCGG 1 cut(s) 44
Hin1II CATG 2 cut(s) 63, 194
HpaII CCGG 1 cut(s) 44
HphI GGTGA 1 cut(s) 48
Hpy166II GTNNAC 2 cut(s) 56, 90
Hpy188III TCNNGA 2 cut(s) 146, 158
Hpy8I GTNNAC 2 cut(s) 56, 90
HpyCH4III ACNGT 2 cut(s) 73, 103
HpyCH4V TGCA 1 cut(s) 128
Hsp92II CATG 2 cut(s) 63, 194
Kzo9I GATC 2 cut(s) 132, 176
LguI GCTCTTC 1 cut(s) 147
LpnPI CCDG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 184
MalI GATC 2 cut(s) 134, 178
MboI GATC 2 cut(s) 132, 176
MboII GAAGA 2 cut(s) 108, 134
MfeI CAATTG 1 cut(s) 201
MflI RGATCY 1 cut(s) 176
MluCI AATT 1 cut(s) 201
MnlI CCTC 1 cut(s) 78
MroXI GAANNNNTTC 1 cut(s) 153
MseI TTAA 1 cut(s) 48
MspI CCGG 1 cut(s) 44
MunI CAATTG 1 cut(s) 201
NcoI CCATGG 1 cut(s) 59
NdeII GATC 2 cut(s) 132, 176
NlaIII CATG 2 cut(s) 63, 194
NlaIV GGNNCC 1 cut(s) 178
NspI RCATGY 1 cut(s) 194
NspV TTCGAA 2 cut(s) 119, 196
PciSI GCTCTTC 1 cut(s) 147
PdmI GAANNNNTTC 1 cut(s) 153
PflMI CCANNNNNTGG 1 cut(s) 28
PshAI GACNNNNGTC 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 178
PsuI RGATCY 1 cut(s) 176
SapI GCTCTTC 1 cut(s) 147
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 2 cut(s) 132, 176
SetI ASST 1 cut(s) 89
SfcI CTRYAG 1 cut(s) 90
SfuI TTCGAA 2 cut(s) 119, 196
SgeI CNNG 7 cut(s) 56, 72, 85, 93, 158, 170, 203
Sse9I AATT 1 cut(s) 201
StyI CCWWGG 1 cut(s) 59
TaaI ACNGT 2 cut(s) 73, 103
TaqI TCGA 2 cut(s) 119, 196
TasI AATT 1 cut(s) 201
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
Van91I CCANNNNNTGG 1 cut(s) 28
XceI RCATGY 1 cut(s) 194
XmiI GTMKAC 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.