Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001998.1

Orthogroup ID

OG0004874

Physical Location & Seq

Genomic Coordinates Forward (+)

40397 .. 42838

Gene Structure 2442 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001998.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

atgaagcaaggctacatcaaaagcgacaacaccaagcataatcagcaacaacagactctcttcaagatcagagtgaaccaggttcgatctgaggacaatgtgtcattacctaaatccacgttcgacaaacatgttgcaagcatcggatcggtggtgttctggtttgacttcaccaccacctcctgggagtaccgcactccgatcctaaccccgcacgggagcttcgtatgtgcgaaggttccggattccgaccagatcgtagtcgccggaggcggttcccgccacaccatgttcagtgcggtcgggagcaggatgacctcggtggagaggtatgatatatatagagacgagtgggtggcaatggaagggctacatagctttcgggtcgggtgtgtgggagttttgggtgatgggcgggtacggccaggcaagggctatatcagaggtggtgccgatggacaagtattaccggaatgcggtggtgatggaattgacgaatcagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0031461 GO:0031463 GO:0032991 GO:0044424 GO:0044464 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like Kelch_1

Protein Analysis

168

Amino Acids

18.56

Weight (kDa)

6.51

Isoelectric Point (pI)

26.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004874)

Species	Orthologous Gene IDs
pyrus_communis	pycom13g24240 pycom520g00420
rosa_chinensis	RchiOBHm_Chr1g0323091 RchiOBHm_Chr1g0367381 RchiOBHm_Chr2g0138291 RchiOBHm_Chr2g0148911 RchiOBHm_Chr2g0150891 RchiOBHm_Chr3g0491271 RchiOBHm_Chr4g0388351 RchiOBHm_Chr4g0435401 RchiOBHm_Chr5g0012171 RchiOBHm_Chr6g0282941 RchiOBHm_Chr7g0185711 RchiOBHm_Chr7g0186831
rosa_multiflora	Rmu_sc0001998.1_g000012
rosa_rugosa	Rorug07G0292400
rosa_wichuraiana	Rw0G004540 Rw1G001620 Rw1G005040 Rw1G013360 Rw1G021570 Rw2G031870 Rw4G000690 Rw5G008320 Rw5G009260 Rw5G022080 Rw6G007050 Rw7G013470 Rw7G020380 Rw7G031880 Rw7G041220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	449
AccB7I	CCANNNNNTGG	1 cut(s)	183
AccIII	TCCGGA	1 cut(s)	241
AciI	CCGC	7 cut(s)	193, 212, 273, 280, 299, 415, 477
AclWI	GGATC	2 cut(s)	154, 196
AcoI	YGGCCR	1 cut(s)	422
AfaI	GTAC	2 cut(s)	191, 420
AfiI	CCNNNNNNNGG	4 cut(s)	183, 216, 431, 476
AflIII	ACRYGT	1 cut(s)	130
AgsI	TTSAA	1 cut(s)	64
AhdI	GACNNNNNGTC	1 cut(s)	100
AjnI	CCWGG	3 cut(s)	78, 182, 424
AluBI	AGCT	2 cut(s)	222, 378
AluI	AGCT	2 cut(s)	222, 378
Alw26I	GTCTC	1 cut(s)	339
AlwI	GGATC	2 cut(s)	154, 196
Aor13HI	TCCGGA	1 cut(s)	241
AoxI	GGCC	1 cut(s)	422
AsuHPI	GGTGA	3 cut(s)	163, 419, 494
BanI	GGYRCC	1 cut(s)	449
BarI	GAAGNNNNNNTAC	1 cut(s)	28
BccI	CCATC	3 cut(s)	404, 449, 479
BceAI	ACGGC	1 cut(s)	437
BciT130I	CCWGG	3 cut(s)	80, 184, 426
BcoDI	GTCTC	1 cut(s)	339
Bme1390I	CCNGG	3 cut(s)	80, 184, 426
BmeRI	GACNNNNNGTC	1 cut(s)	100
BmiI	GGNNCC	3 cut(s)	240, 277, 451
BmrFI	CCNGG	3 cut(s)	80, 184, 426
BmsI	GCATC	1 cut(s)	150
BsaJI	CCNNGG	2 cut(s)	183, 318
BsaWI	WCCGGW	2 cut(s)	241, 469
Bsc4I	CCNNNNNNNGG	4 cut(s)	183, 216, 431, 476
Bse3DI	GCAATG	1 cut(s)	366
BseAI	TCCGGA	1 cut(s)	241
BseBI	CCWGG	3 cut(s)	80, 184, 426
BseDI	CCNNGG	2 cut(s)	183, 318
BseGI	GGATG	1 cut(s)	318
BseLI	CCNNNNNNNGG	4 cut(s)	183, 216, 431, 476
BseMI	GCAATG	1 cut(s)	366
BseMII	CTCAG	1 cut(s)	81
Bsh1285I	CGRYCG	1 cut(s)	303
BshFI	GGCC	1 cut(s)	424
BshNI	GGYRCC	1 cut(s)	449
BsiEI	CGRYCG	1 cut(s)	303
BsiSI	CCGG	3 cut(s)	242, 267, 470
BslI	CCNNNNNNNGG	4 cut(s)	183, 216, 431, 476
BsmAI	GTCTC	1 cut(s)	339
BsmBI	CGTCTC	1 cut(s)	339
BsmI	GAATGC	1 cut(s)	479
BsnI	GGCC	1 cut(s)	424
Bsp13I	TCCGGA	1 cut(s)	241
Bsp143I	GATC	5 cut(s)	66, 86, 146, 201, 255
BspACI	CCGC	7 cut(s)	193, 212, 273, 280, 299, 415, 477
BspANI	GGCC	1 cut(s)	424
BspCNI	CTCAG	1 cut(s)	82
BspEI	TCCGGA	1 cut(s)	241
BspLI	GGNNCC	3 cut(s)	240, 277, 451
BspPI	GGATC	2 cut(s)	154, 196
BspT107I	GGYRCC	1 cut(s)	449
BsrDI	GCAATG	1 cut(s)	366
BssECI	CCNNGG	2 cut(s)	183, 318
BssMI	GATC	5 cut(s)	66, 86, 146, 201, 255
Bst2UI	CCWGG	3 cut(s)	80, 184, 426
Bst6I	CTCTTC	1 cut(s)	65
BstC8I	GCNNGC	1 cut(s)	139
BstDEI	CTNAG	1 cut(s)	90
BstF5I	GGATG	1 cut(s)	318
BstKTI	GATC	5 cut(s)	69, 89, 149, 204, 258
BstMAI	GTCTC	1 cut(s)	339
BstMBI	GATC	5 cut(s)	66, 86, 146, 201, 255
BstMCI	CGRYCG	1 cut(s)	303
BstMWI	GCNNNNNNNGC	3 cut(s)	43, 279, 421
BstNI	CCWGG	3 cut(s)	80, 184, 426
BstNSI	RCATGY	1 cut(s)	134
BstSCI	CCNGG	3 cut(s)	78, 182, 424
BsuRI	GGCC	1 cut(s)	424
BtsCI	GGATG	1 cut(s)	318
BtsIMutI	CAGTG	1 cut(s)	301
Cac8I	GCNNGC	1 cut(s)	139
CsiI	ACCWGGT	1 cut(s)	78
Csp6I	GTAC	2 cut(s)	190, 419
CviAII	CATG	2 cut(s)	131, 289
CviJI	RGCY	6 cut(s)	12, 222, 370, 378, 424, 435
CviKI_1	RGCY	6 cut(s)	12, 222, 370, 378, 424, 435
CviQI	GTAC	2 cut(s)	190, 419
DdeI	CTNAG	1 cut(s)	90
DpnI	GATC	5 cut(s)	68, 88, 148, 203, 257
DpnII	GATC	5 cut(s)	66, 86, 146, 201, 255
DriI	GACNNNNNGTC	1 cut(s)	100
EaeI	YGGCCR	1 cut(s)	422
Eam1104I	CTCTTC	1 cut(s)	65
Eam1105I	GACNNNNNGTC	1 cut(s)	100
EarI	CTCTTC	1 cut(s)	65
EcoRII	CCWGG	3 cut(s)	78, 182, 424
Esp3I	CGTCTC	1 cut(s)	339
FaeI	CATG	2 cut(s)	134, 292
FatI	CATG	2 cut(s)	130, 288
FauI	CCCGC	3 cut(s)	219, 287, 408
FokI	GGATG	1 cut(s)	325
HaeIII	GGCC	1 cut(s)	424
HapII	CCGG	3 cut(s)	242, 267, 470
Hin1II	CATG	2 cut(s)	134, 292
HinfI	GANTC	3 cut(s)	55, 245, 497
HpaII	CCGG	3 cut(s)	242, 267, 470
HphI	GGTGA	3 cut(s)	163, 419, 494
Hpy166II	GTNNAC	1 cut(s)	76
Hpy188I	TCNGA	7 cut(s)	71, 91, 146, 201, 250, 443, 502
Hpy188III	TCNNGA	3 cut(s)	64, 242, 304
Hpy8I	GTNNAC	1 cut(s)	76
HpyAV	CCTTC	2 cut(s)	229, 359
HpyCH4IV	ACGT	1 cut(s)	119
HpyCH4V	TGCA	1 cut(s)	137
HpyF10VI	GCNNNNNNNGC	3 cut(s)	43, 279, 421
HpyF3I	CTNAG	1 cut(s)	90
HpySE526I	ACGT	1 cut(s)	119
Hsp92II	CATG	2 cut(s)	134, 292
Kpn2I	TCCGGA	1 cut(s)	241
Kzo9I	GATC	5 cut(s)	66, 86, 146, 201, 255
LmnI	GCTCC	2 cut(s)	219, 306
LweI	GCATC	1 cut(s)	150
MabI	ACCWGGT	1 cut(s)	78
MaeII	ACGT	1 cut(s)	119
MalI	GATC	5 cut(s)	68, 88, 148, 203, 257
MboI	GATC	5 cut(s)	66, 86, 146, 201, 255
MboII	GAAGA	1 cut(s)	52
MluCI	AATT	1 cut(s)	489
MlyI	GAGTC	1 cut(s)	49
MmeI	TCCRAC	1 cut(s)	273
MnlI	CCTC	6 cut(s)	85, 190, 263, 321, 328, 437
MroI	TCCGGA	1 cut(s)	241
MspI	CCGG	3 cut(s)	242, 267, 470
MspR9I	CCNGG	3 cut(s)	80, 184, 426
Mva1269I	GAATGC	1 cut(s)	479
MvaI	CCWGG	3 cut(s)	80, 184, 426
MwoI	GCNNNNNNNGC	3 cut(s)	43, 279, 421
NdeII	GATC	5 cut(s)	66, 86, 146, 201, 255
NlaIII	CATG	2 cut(s)	134, 292
NlaIV	GGNNCC	3 cut(s)	240, 277, 451
NspI	RCATGY	1 cut(s)	134
PciI	ACATGT	1 cut(s)	130
PcsI	WCGNNNNNNNCGW	1 cut(s)	222
PctI	GAATGC	1 cut(s)	479
PfeI	GAWTC	2 cut(s)	245, 497
PflMI	CCANNNNNTGG	1 cut(s)	183
PleI	GAGTC	1 cut(s)	49
PpsI	GAGTC	1 cut(s)	49
PscI	ACATGT	1 cut(s)	130
Psp6I	CCWGG	3 cut(s)	78, 182, 424
PspGI	CCWGG	3 cut(s)	78, 182, 424
PspN4I	GGNNCC	3 cut(s)	240, 277, 451
RsaI	GTAC	2 cut(s)	191, 420
RsaNI	GTAC	2 cut(s)	190, 419
Sau3AI	GATC	5 cut(s)	66, 86, 146, 201, 255
SchI	GAGTC	1 cut(s)	49
ScrFI	CCNGG	3 cut(s)	80, 184, 426
SexAI	ACCWGGT	1 cut(s)	78
SfaNI	GCATC	1 cut(s)	150
Sse9I	AATT	1 cut(s)	489
SsiI	CCGC	7 cut(s)	193, 212, 273, 280, 299, 415, 477
StyD4I	CCNGG	3 cut(s)	78, 182, 424
TaiI	ACGT	1 cut(s)	122
TaqI	TCGA	2 cut(s)	85, 123
TasI	AATT	1 cut(s)	489
TfiI	GAWTC	2 cut(s)	245, 497
TscAI	CASTG	1 cut(s)	301
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	301
Van91I	CCANNNNNTGG	1 cut(s)	183
XceI	RCATGY	1 cut(s)	134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.