RchiOBHm_Chr4g0442251
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
63913554 .. 63913742
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGATGCAATCAACTTCGATGTGCCGTTAAATGAAGCAGTAAAGATGTGGCAGGCTGCGGAGGGCAAAAGCAACATTGATGAATCCTCATCTTCATCGATCTTTCCTAGCGGGCATACCACCCAGACCAGCCTTCCTAATCGGCCTTGTGGATTTGCAGAGTCGTTTACATCATCAGATGGGCGGTAA

Protein Analysis

62

Amino Acids

6.65

Weight (kDa)

4.5

Isoelectric Point (pI)

53.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 59, 111, 184
AoxI GGCC 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 56
BbvI GCAGC 1 cut(s) 43
BccI CCATC 1 cut(s) 173
BceAI ACGGC 1 cut(s) 10
BfaI CTAG 1 cut(s) 108
BisI GCNGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 58
Bsa29I ATCGAT 1 cut(s) 98
BseCI ATCGAT 1 cut(s) 98
BseGI GGATG 1 cut(s) 10
BseXI GCAGC 1 cut(s) 43
BshFI GGCC 1 cut(s) 145
BshVI ATCGAT 1 cut(s) 98
BsnI GGCC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 99
BspACI CCGC 3 cut(s) 59, 111, 184
BspANI GGCC 1 cut(s) 145
BspDI ATCGAT 1 cut(s) 98
BssMI GATC 1 cut(s) 99
BstC8I GCNNGC 2 cut(s) 54, 113
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 102
BstMBI GATC 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 43
Bsu15I ATCGAT 1 cut(s) 98
BsuRI GGCC 1 cut(s) 145
BsuTUI ATCGAT 1 cut(s) 98
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 2 cut(s) 54, 113
ClaI ATCGAT 1 cut(s) 98
CviJI RGCY 3 cut(s) 56, 132, 145
CviKI_1 RGCY 3 cut(s) 56, 132, 145
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
FaiI YATR 1 cut(s) 117
FauI CCCGC 1 cut(s) 104
Fnu4HI GCNGC 1 cut(s) 57
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 57
FspBI CTAG 1 cut(s) 108
GluI GCNGC 1 cut(s) 57
HaeIII GGCC 1 cut(s) 145
HinfI GANTC 2 cut(s) 83, 161
Hpy166II GTNNAC 1 cut(s) 168
Hpy188I TCNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 168
HpyAV CCTTC 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 8, 158
Kzo9I GATC 1 cut(s) 99
LpnPI CCDG 3 cut(s) 38, 137, 142
Lsp1109I GCAGC 1 cut(s) 43
MaeI CTAG 1 cut(s) 108
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MboII GAAGA 1 cut(s) 84
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 2 cut(s) 55, 97
MseI TTAA 1 cut(s) 29
NdeII GATC 1 cut(s) 99
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 58
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 29
SatI GCNGC 1 cut(s) 57
Sau3AI GATC 1 cut(s) 99
SchI GAGTC 1 cut(s) 170
SgeI CNNG 6 cut(s) 65, 120, 124, 136, 141, 159
SsiI CCGC 3 cut(s) 59, 111, 184
SspMI CTAG 1 cut(s) 108
TaqI TCGA 2 cut(s) 18, 98
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseI GCWGC 1 cut(s) 56
TspDTI ATGAA 3 cut(s) 48, 84, 96
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.